Incidental Mutation 'R4517:Cyp4f37'
ID332968
Institutional Source Beutler Lab
Gene Symbol Cyp4f37
Ensembl Gene ENSMUSG00000062464
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 37
SynonymsGm9705
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32621319-32636184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32631592 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 340 (I340V)
Ref Sequence ENSEMBL: ENSMUSP00000076827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077639]
Predicted Effect probably benign
Transcript: ENSMUST00000077639
AA Change: I340V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000076827
Gene: ENSMUSG00000062464
AA Change: I340V

DomainStartEndE-ValueType
Pfam:p450 52 515 1.1e-136 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Cyp4f37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cyp4f37 APN 17 32629053 missense probably benign 0.20
IGL01994:Cyp4f37 APN 17 32625176 nonsense probably null
IGL02073:Cyp4f37 APN 17 32627851 missense possibly damaging 0.59
IGL02145:Cyp4f37 APN 17 32630035 missense probably benign 0.43
IGL02814:Cyp4f37 APN 17 32634671 missense probably benign 0.01
IGL02873:Cyp4f37 APN 17 32625168 missense probably benign 0.00
IGL02937:Cyp4f37 APN 17 32625189 missense probably benign 0.00
IGL03170:Cyp4f37 APN 17 32625119 splice site probably benign
R0625:Cyp4f37 UTSW 17 32634678 missense probably damaging 1.00
R1774:Cyp4f37 UTSW 17 32629890 missense possibly damaging 0.59
R1871:Cyp4f37 UTSW 17 32634665 missense probably damaging 1.00
R2232:Cyp4f37 UTSW 17 32634270 missense probably benign 0.23
R2847:Cyp4f37 UTSW 17 32629125 missense probably damaging 1.00
R2848:Cyp4f37 UTSW 17 32629125 missense probably damaging 1.00
R4027:Cyp4f37 UTSW 17 32631672 missense probably benign 0.00
R4463:Cyp4f37 UTSW 17 32627736 critical splice acceptor site probably null
R4573:Cyp4f37 UTSW 17 32629087 missense probably benign 0.23
R4670:Cyp4f37 UTSW 17 32625152 missense probably benign
R5752:Cyp4f37 UTSW 17 32631332 missense probably damaging 1.00
R5930:Cyp4f37 UTSW 17 32629983 missense possibly damaging 0.79
R6248:Cyp4f37 UTSW 17 32629890 missense possibly damaging 0.59
R7412:Cyp4f37 UTSW 17 32629844 missense possibly damaging 0.87
R8066:Cyp4f37 UTSW 17 32635073 missense probably benign 0.21
R8187:Cyp4f37 UTSW 17 32635197 missense probably benign
X0057:Cyp4f37 UTSW 17 32625224 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAGAGGTGTGCCAGTCTCAAG -3'
(R):5'- AATCCCTAAAAGCACGGGG -3'

Sequencing Primer
(F):5'- GCCAGTCTCAAGTAACTATTTTGGG -3'
(R):5'- GGGGTTAAGACTCTGTAATCCAACC -3'
Posted On2015-08-18