Incidental Mutation 'R4517:H2-M10.3'
ID332969
Institutional Source Beutler Lab
Gene Symbol H2-M10.3
Ensembl Gene ENSMUSG00000058124
Gene Namehistocompatibility 2, M region locus 10.3
Synonyms5.3H
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36365003-36368417 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 36367830 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073546]
Predicted Effect probably null
Transcript: ENSMUST00000073546
SMART Domains Protein: ENSMUSP00000073236
Gene: ENSMUSG00000058124

DomainStartEndE-ValueType
Pfam:MHC_I 24 202 7e-51 PFAM
IGc1 221 292 6.58e-22 SMART
transmembrane domain 305 327 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in H2-M10.3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02223:H2-M10.3 APN 17 36368080 missense possibly damaging 0.84
IGL02410:H2-M10.3 APN 17 36366536 missense probably damaging 1.00
IGL02625:H2-M10.3 APN 17 36367525 missense probably benign 0.00
IGL03218:H2-M10.3 APN 17 36367387 missense probably damaging 0.99
R0815:H2-M10.3 UTSW 17 36366690 missense probably damaging 1.00
R0863:H2-M10.3 UTSW 17 36366690 missense probably damaging 1.00
R1463:H2-M10.3 UTSW 17 36366720 missense probably damaging 1.00
R1737:H2-M10.3 UTSW 17 36368404 missense probably benign 0.22
R1833:H2-M10.3 UTSW 17 36367495 missense probably damaging 1.00
R1954:H2-M10.3 UTSW 17 36367498 missense probably damaging 1.00
R4515:H2-M10.3 UTSW 17 36367830 splice site probably null
R4519:H2-M10.3 UTSW 17 36367830 splice site probably null
R4834:H2-M10.3 UTSW 17 36367394 missense probably benign 0.28
R4863:H2-M10.3 UTSW 17 36366636 missense probably damaging 1.00
R5473:H2-M10.3 UTSW 17 36367369 missense probably damaging 0.97
R6038:H2-M10.3 UTSW 17 36368395 missense probably benign 0.15
R6038:H2-M10.3 UTSW 17 36368395 missense probably benign 0.15
R7192:H2-M10.3 UTSW 17 36366559 missense probably damaging 1.00
R7515:H2-M10.3 UTSW 17 36366543 missense probably damaging 1.00
R7884:H2-M10.3 UTSW 17 36366282 missense probably benign 0.38
R7967:H2-M10.3 UTSW 17 36366282 missense probably benign 0.38
Z1177:H2-M10.3 UTSW 17 36366579 missense probably damaging 1.00
Z1177:H2-M10.3 UTSW 17 36367544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTTTGTCCCCAACGTAACC -3'
(R):5'- TGGCATGATTAATTCCCGGTTC -3'

Sequencing Primer
(F):5'- CCCTTAACTAGATCACAATCTGTTG -3'
(R):5'- GGTTCATCCACATTGGCTATGTAGAC -3'
Posted On2015-08-18