Incidental Mutation 'R4517:Fam122c'
ID332973
Institutional Source Beutler Lab
Gene Symbol Fam122c
Ensembl Gene ENSMUSG00000036013
Gene Namefamily with sequence similarity 122, member C
Synonyms
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4517 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location53273424-53331185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53293499 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 94 (R94H)
Ref Sequence ENSEMBL: ENSMUSP00000139776 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000114835
AA Change: R94H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000124137
AA Change: R94H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000186314
AA Change: R94H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Fam122c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4198:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4199:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4361:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4515:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4518:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4519:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4522:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4523:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4529:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4530:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4532:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4533:Fam122c UTSW X 53293499 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATTGCTGCTGTACACTCAATAAG -3'
(R):5'- GTAATCGGCTATGACTGCTTTTAG -3'

Sequencing Primer
(F):5'- GAATCAGGGTTTCTCTGTATAGCCC -3'
(R):5'- AAGCCTCCTGATGATGACCTG -3'
Posted On2015-08-18