Incidental Mutation 'R4528:Zfp985'
ID332986
Institutional Source Beutler Lab
Gene Symbol Zfp985
Ensembl Gene ENSMUSG00000065999
Gene Namezinc finger protein 985
SynonymsGm13154
MMRRC Submission 041769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R4528 (G1)
Quality Score147
Status Not validated
Chromosome4
Chromosomal Location147553277-147585198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 147582890 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 72 (I72F)
Ref Sequence ENSEMBL: ENSMUSP00000123296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081742] [ENSMUST00000139784] [ENSMUST00000143885]
Predicted Effect probably benign
Transcript: ENSMUST00000081742
AA Change: I72F

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080438
Gene: ENSMUSG00000065999
AA Change: I72F

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
ZnF_C2H2 238 260 8.34e-3 SMART
ZnF_C2H2 266 288 1.47e-3 SMART
ZnF_C2H2 294 316 2.36e-2 SMART
ZnF_C2H2 322 344 8.34e-3 SMART
ZnF_C2H2 350 372 7.67e-2 SMART
ZnF_C2H2 378 400 8.6e-5 SMART
ZnF_C2H2 406 428 8.6e-5 SMART
ZnF_C2H2 434 456 7.9e-4 SMART
ZnF_C2H2 462 484 1.95e-3 SMART
ZnF_C2H2 490 512 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139784
AA Change: I72F

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123296
Gene: ENSMUSG00000065999
AA Change: I72F

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143885
AA Change: I72F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121177
Gene: ENSMUSG00000065999
AA Change: I72F

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm A T 9: 53,500,759 I999K probably benign Het
Camsap3 A G 8: 3,606,515 E535G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpu G T 8: 46,562,422 G34* probably null Het
Col7a1 C A 9: 108,959,533 A739D unknown Het
Coro1b T C 19: 4,149,981 V107A probably benign Het
Cpeb3 T C 19: 37,139,088 D381G possibly damaging Het
Cyp2a22 T C 7: 26,934,769 D320G possibly damaging Het
Dcaf1 A T 9: 106,844,204 K398N probably damaging Het
Etfa A G 9: 55,500,050 S52P probably damaging Het
Fat4 T A 3: 38,891,294 H1445Q probably benign Het
Foxred2 T A 15: 77,943,249 M637L probably benign Het
Gbe1 A T 16: 70,478,337 I342L probably benign Het
Gm14410 G T 2: 177,193,941 H177N probably damaging Het
Gm14410 A T 2: 177,193,943 I176K probably benign Het
Gm1527 T A 3: 28,914,393 M198K probably damaging Het
Hr T C 14: 70,566,383 L838P probably damaging Het
Kmt2e T C 5: 23,473,558 S212P possibly damaging Het
Lims1 T C 10: 58,410,060 C180R probably damaging Het
Mki67 A T 7: 135,695,359 S2649T probably damaging Het
Olfr1308 T C 2: 111,960,948 N42D probably damaging Het
Olfr417 T A 1: 174,369,256 L113H probably damaging Het
Olfr574 A G 7: 102,948,806 M104V probably damaging Het
Pde4dip C T 3: 97,717,022 E1399K probably damaging Het
Pex1 T C 5: 3,631,712 Y1053H probably damaging Het
Plscr2 G A 9: 92,289,693 E113K possibly damaging Het
Pus1 T C 5: 110,774,730 Y309C probably damaging Het
Scube3 T A 17: 28,162,999 V333D possibly damaging Het
Serpina11 A T 12: 103,986,333 N66K probably benign Het
Thtpa T A 14: 55,095,582 D41E probably damaging Het
Timm10b A G 7: 105,682,806 N828S probably benign Het
Tlr12 A C 4: 128,618,025 L144R probably damaging Het
Uba7 A G 9: 107,983,903 E964G possibly damaging Het
Ugt1a6b T A 1: 88,107,579 I213N probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zbtb43 A G 2: 33,462,325 probably benign Het
Zfpm1 G A 8: 122,335,642 R480H probably benign Het
Other mutations in Zfp985
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0098:Zfp985 UTSW 4 147577109 missense probably damaging 0.97
R0324:Zfp985 UTSW 4 147582857 missense probably benign 0.00
R1307:Zfp985 UTSW 4 147583247 missense probably benign
R1594:Zfp985 UTSW 4 147583080 missense probably benign 0.05
R1657:Zfp985 UTSW 4 147584110 missense probably benign 0.01
R1667:Zfp985 UTSW 4 147583950 missense possibly damaging 0.84
R1761:Zfp985 UTSW 4 147584045 missense probably benign 0.00
R1858:Zfp985 UTSW 4 147582858 missense probably benign 0.29
R2509:Zfp985 UTSW 4 147582986 missense possibly damaging 0.75
R2510:Zfp985 UTSW 4 147582986 missense possibly damaging 0.75
R2847:Zfp985 UTSW 4 147583011 nonsense probably null
R2848:Zfp985 UTSW 4 147583011 nonsense probably null
R4245:Zfp985 UTSW 4 147582939 missense probably damaging 0.96
R4260:Zfp985 UTSW 4 147583572 missense probably damaging 1.00
R4434:Zfp985 UTSW 4 147583911 missense probably benign 0.37
R4480:Zfp985 UTSW 4 147584079 missense probably benign 0.07
R4512:Zfp985 UTSW 4 147583563 missense probably damaging 1.00
R4514:Zfp985 UTSW 4 147583563 missense probably damaging 1.00
R4836:Zfp985 UTSW 4 147584155 missense probably damaging 0.97
R4884:Zfp985 UTSW 4 147583344 missense probably benign 0.04
R5054:Zfp985 UTSW 4 147582981 missense probably damaging 0.98
R5106:Zfp985 UTSW 4 147584155 missense probably damaging 0.97
R5205:Zfp985 UTSW 4 147582911 missense probably damaging 1.00
R5266:Zfp985 UTSW 4 147582832 critical splice acceptor site probably null
R5468:Zfp985 UTSW 4 147583245 missense probably benign
R5533:Zfp985 UTSW 4 147582983 nonsense probably null
R6282:Zfp985 UTSW 4 147583348 missense probably benign 0.00
R6303:Zfp985 UTSW 4 147583775 missense probably benign 0.01
R6609:Zfp985 UTSW 4 147583121 missense probably benign
R6609:Zfp985 UTSW 4 147583667 missense probably damaging 1.00
R6722:Zfp985 UTSW 4 147583071 missense probably benign 0.26
R6858:Zfp985 UTSW 4 147583307 nonsense probably null
R7064:Zfp985 UTSW 4 147583116 missense probably benign 0.20
R7216:Zfp985 UTSW 4 147583456 missense probably damaging 1.00
R7471:Zfp985 UTSW 4 147582931 missense possibly damaging 0.75
R7583:Zfp985 UTSW 4 147583489 nonsense probably null
R7685:Zfp985 UTSW 4 147582874 missense probably benign 0.00
X0050:Zfp985 UTSW 4 147583271 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGGTTCTTCTGAGGATACATGTAG -3'
(R):5'- TGGATTCCTTGATTGAGACTAATGG -3'

Sequencing Primer
(F):5'- GAGAGAGAGAGAGAGAGACCTC -3'
(R):5'- ACAAACTTACACTGTTTACAGAGTC -3'
Posted On2015-08-18