Mutagenetix > Incidental Mutations

Incidental Mutation 'R0107:Scn1a'

33299

Institutional Source

Beutler Lab

Gene Symbol

Scn1a

Ensembl Gene

ENSMUSG00000064329

Gene Name

sodium channel, voltage-gated, type I, alpha

Synonyms

Nav1.1

MMRRC Submission

038393-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0107 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

66270778-66440840 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66324633 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 661 (T661S)

Ref Sequence

ENSEMBL: ENSMUSP00000107990 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000138910]

Predicted Effect

probably benign
Transcript: ENSMUST00000077489
AA Change: T661S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: T661S

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094951

SMART Domains

Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.3e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	691	2e-62	PFAM
Pfam:Ion_trans	774	963	6.7e-47	PFAM
Pfam:Na_trans_assoc	978	1200	1.2e-74	PFAM
Pfam:Ion_trans	1226	1454	1e-56	PFAM
PDB:1BYY\|A	1456	1508	4e-31	PDB
Pfam:Ion_trans	1547	1757	1.1e-51	PFAM
Pfam:PKD_channel	1606	1764	3.8e-7	PFAM
low complexity region	1809	1821	N/A	INTRINSIC
IQ	1886	1908	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112366
AA Change: T661S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: T661S

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	127	434	2.8e-82	PFAM
Pfam:Na_trans_cytopl	502	718	2e-91	PFAM
Pfam:Ion_trans	767	1002	6.5e-57	PFAM
Pfam:Na_trans_assoc	1006	1213	1.2e-60	PFAM
Pfam:Ion_trans	1217	1493	3.3e-67	PFAM
Pfam:Ion_trans	1540	1797	6.3e-56	PFAM
Pfam:PKD_channel	1637	1791	1.1e-6	PFAM
low complexity region	1837	1849	N/A	INTRINSIC
IQ	1914	1936	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112371
AA Change: T661S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: T661S

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138910

SMART Domains

Protein: ENSMUSP00000116881
Gene: ENSMUSG00000064329

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
transmembrane domain	125	147	N/A	INTRINSIC

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.6%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,080,834	V825A	probably benign	Het
Adamts7	T	C	9: 90,180,720	I409T	possibly damaging	Het
Adck1	T	C	12: 88,446,656	W253R	possibly damaging	Het
Afg3l2	A	G	18: 67,431,766	F213L	probably damaging	Het
Ankle2	T	C	5: 110,253,027	V743A	probably benign	Het
Ankrd34c	C	T	9: 89,729,484	R268H	probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc7b	T	G	8: 129,178,197		probably benign	Het
Cd320	A	T	17: 33,848,085	M169L	probably benign	Het
Chn1	A	G	2: 73,614,684	Y338H	probably damaging	Het
Chuk	T	A	19: 44,096,919	S263C	probably damaging	Het
Dennd4b	C	A	3: 90,272,736	P663T	possibly damaging	Het
Dnajc24	T	G	2: 106,001,914		probably benign	Het
Fam172a	A	G	13: 77,902,814	D145G	probably damaging	Het
Fbn2	A	G	18: 58,056,203	V1617A	probably benign	Het
Fermt2	T	C	14: 45,464,822	N502D	probably damaging	Het
Frrs1	A	T	3: 116,896,716	I3F	probably damaging	Het
Fut1	C	A	7: 45,618,846	Q20K	possibly damaging	Het
Gbf1	T	C	19: 46,284,828	V1709A	probably benign	Het
Gfra3	G	T	18: 34,711,306	H60Q	probably benign	Het
Gm10750	T	A	2: 149,016,053	M93L	unknown	Het
Gm5538	T	A	3: 59,752,316	L397I	possibly damaging	Het
Hmcn1	T	A	1: 150,587,015	I5124L	probably benign	Het
Hps3	A	C	3: 20,030,796	L76R	probably damaging	Het
Ifrd1	T	A	12: 40,214,081	Q105L	probably damaging	Het
Irs2	A	T	8: 11,004,691	V1247E	probably damaging	Het
Itgal	T	C	7: 127,328,559		probably benign	Het
Ivns1abp	A	T	1: 151,361,570	N495I	probably damaging	Het
Kank1	T	A	19: 25,430,366		probably benign	Het
Mroh8	T	C	2: 157,225,468	Q657R	probably benign	Het
Mthfd1l	T	C	10: 4,041,838	Y597H	probably benign	Het
Myom1	G	A	17: 71,077,365	V692I	probably damaging	Het
Olfr347	T	G	2: 36,734,718	Y132*	probably null	Het
Olfr45	A	T	7: 140,691,345	M147L	probably benign	Het
Olfr835	A	G	9: 19,035,333	D70G	probably damaging	Het
Palmd	A	T	3: 116,924,076	H257Q	probably damaging	Het
Pcnx2	A	T	8: 125,753,586	V1994D	probably benign	Het
Phkb	G	A	8: 86,016,931	G553S	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Ptprn	A	T	1: 75,255,712	L453M	probably damaging	Het
Ptprz1	T	A	6: 23,000,570	D886E	probably damaging	Het
Rcn1	T	A	2: 105,394,781	I110F	possibly damaging	Het
Slc6a19	A	G	13: 73,684,057	Y467H	possibly damaging	Het
Slc9c1	T	A	16: 45,575,420	D611E	probably benign	Het
Slitrk6	T	C	14: 110,751,963	E104G	possibly damaging	Het
Spag17	A	T	3: 100,050,787	K920N	possibly damaging	Het
St3gal5	A	G	6: 72,142,149	S82G	probably benign	Het
Tlk1	T	C	2: 70,713,989	*767W	probably null	Het
Tln2	A	G	9: 67,370,706	V342A	probably damaging	Het
Tmem104	T	A	11: 115,202,180	M132K	probably damaging	Het
Tmem184c	A	G	8: 77,597,073	S387P	possibly damaging	Het
Tmtc1	A	G	6: 148,425,913	V34A	possibly damaging	Het
Trim46	A	G	3: 89,236,333	F596S	probably damaging	Het
Unc79	T	A	12: 103,134,525	D1870E	possibly damaging	Het
Utp20	T	C	10: 88,778,391	T1234A	probably benign	Het
Vmn1r31	T	A	6: 58,472,743	T46S	probably benign	Het
Vps13a	A	T	19: 16,691,824	L1341Q	probably benign	Het
Wdr72	A	T	9: 74,210,433	D821V	probably damaging	Het
Zfhx4	T	C	3: 5,398,982	L1400P	probably damaging	Het
Zfp217	T	A	2: 170,114,874	K735*	probably null	Het
Zfp235	A	G	7: 24,137,116	Q29R	probably damaging	Het
Zfp628	A	G	7: 4,920,168	Y463C	probably damaging	Het
Zkscan4	A	G	13: 21,484,581	T401A	possibly damaging	Het

Other mutations in Scn1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Scn1a	APN	2	66335531	critical splice acceptor site	probably null
IGL00650:Scn1a	APN	2	66280793	missense	probably damaging	1.00
IGL00658:Scn1a	APN	2	66286038	missense	probably damaging	1.00
IGL00823:Scn1a	APN	2	66324935	missense	probably benign	0.04
IGL00907:Scn1a	APN	2	66327797	missense	probably damaging	1.00
IGL01339:Scn1a	APN	2	66325960	missense	probably benign	0.09
IGL01401:Scn1a	APN	2	66289111	missense	probably damaging	1.00
IGL01503:Scn1a	APN	2	66322343	missense	probably damaging	1.00
IGL01575:Scn1a	APN	2	66273236	missense	probably damaging	1.00
IGL01598:Scn1a	APN	2	66302485	missense	possibly damaging	0.63
IGL01613:Scn1a	APN	2	66285937	missense	probably damaging	1.00
IGL01796:Scn1a	APN	2	66332301	splice site	probably benign
IGL02079:Scn1a	APN	2	66323360	missense	probably benign	0.14
IGL02171:Scn1a	APN	2	66273199	missense	probably damaging	1.00
IGL02335:Scn1a	APN	2	66277661	missense	possibly damaging	0.93
IGL02406:Scn1a	APN	2	66326036	missense	possibly damaging	0.88
IGL02436:Scn1a	APN	2	66351153	missense	probably benign	0.01
IGL02507:Scn1a	APN	2	66277813	missense	probably damaging	1.00
IGL02646:Scn1a	APN	2	66299618	splice site	probably null
IGL02729:Scn1a	APN	2	66299650	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66324762	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66318077	missense	probably benign	0.00
IGL02752:Scn1a	APN	2	66331412	missense	probably damaging	1.00
IGL02815:Scn1a	APN	2	66324858	missense	probably damaging	1.00
IGL03163:Scn1a	APN	2	66318074	missense	probably benign	0.00
IGL03229:Scn1a	APN	2	66299713	missense	probably damaging	1.00
IGL03286:Scn1a	APN	2	66277576	missense	probably damaging	0.99
IGL03393:Scn1a	APN	2	66318018	missense	probably benign	0.19
BB008:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
BB018:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
PIT4791001:Scn1a	UTSW	2	66273282	missense	probably benign	0.18
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0141:Scn1a	UTSW	2	66289062	missense	probably damaging	1.00
R0485:Scn1a	UTSW	2	66273925	missense	probably damaging	0.98
R0517:Scn1a	UTSW	2	66302407	missense	possibly damaging	0.88
R0532:Scn1a	UTSW	2	66317823	missense	probably damaging	1.00
R0746:Scn1a	UTSW	2	66351126	missense	probably benign	0.25
R0755:Scn1a	UTSW	2	66321035	missense	probably damaging	1.00
R0830:Scn1a	UTSW	2	66299784	missense	probably damaging	1.00
R0846:Scn1a	UTSW	2	66324755	missense	probably benign	0.43
R0918:Scn1a	UTSW	2	66323307	splice site	probably null
R1055:Scn1a	UTSW	2	66337996	missense	probably benign	0.08
R1432:Scn1a	UTSW	2	66322429	missense	probably damaging	1.00
R1497:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R1512:Scn1a	UTSW	2	66331285	missense	possibly damaging	0.82
R1525:Scn1a	UTSW	2	66319462	nonsense	probably null
R1567:Scn1a	UTSW	2	66273331	missense	probably damaging	1.00
R1702:Scn1a	UTSW	2	66318223	missense	probably damaging	1.00
R1744:Scn1a	UTSW	2	66322276	missense	probably benign	0.06
R1834:Scn1a	UTSW	2	66324616	missense	probably benign	0.04
R1834:Scn1a	UTSW	2	66324617	missense	probably benign	0.00
R1860:Scn1a	UTSW	2	66317982	missense	probably damaging	0.99
R1871:Scn1a	UTSW	2	66318025	missense	probably damaging	0.98
R1909:Scn1a	UTSW	2	66331352	missense	possibly damaging	0.58
R1967:Scn1a	UTSW	2	66328425	missense	probably damaging	1.00
R1976:Scn1a	UTSW	2	66331271	missense	probably benign	0.02
R2291:Scn1a	UTSW	2	66288968	missense	probably benign	0.44
R2302:Scn1a	UTSW	2	66277745	missense	probably damaging	1.00
R2367:Scn1a	UTSW	2	66327679	missense	probably damaging	1.00
R2418:Scn1a	UTSW	2	66273843	missense	probably damaging	0.98
R2517:Scn1a	UTSW	2	66273832	missense	probably damaging	1.00
R2568:Scn1a	UTSW	2	66273469	missense	probably damaging	1.00
R3083:Scn1a	UTSW	2	66299637	missense	probably damaging	1.00
R3903:Scn1a	UTSW	2	66318132	missense	probably benign	0.08
R3909:Scn1a	UTSW	2	66273988	missense	probably damaging	1.00
R3916:Scn1a	UTSW	2	66277613	missense	probably damaging	1.00
R3935:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R3936:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R4043:Scn1a	UTSW	2	66326036	missense	possibly damaging	0.60
R4429:Scn1a	UTSW	2	66350985	missense	possibly damaging	0.77
R4495:Scn1a	UTSW	2	66280802	critical splice acceptor site	probably null
R4662:Scn1a	UTSW	2	66350988	missense	probably benign	0.23
R4834:Scn1a	UTSW	2	66328522	nonsense	probably null
R4873:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R4875:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R5099:Scn1a	UTSW	2	66277801	missense	probably damaging	1.00
R5255:Scn1a	UTSW	2	66277669	missense	probably damaging	0.99
R5435:Scn1a	UTSW	2	66273534	missense	probably damaging	1.00
R5449:Scn1a	UTSW	2	66321002	missense	probably damaging	0.96
R5519:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R5541:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R5556:Scn1a	UTSW	2	66324797	missense	probably benign	0.00
R5587:Scn1a	UTSW	2	66273081	missense	probably benign	0.01
R5972:Scn1a	UTSW	2	66351110	missense	possibly damaging	0.65
R5992:Scn1a	UTSW	2	66335456	missense	probably damaging	1.00
R6195:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6233:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6328:Scn1a	UTSW	2	66273316	missense	probably damaging	1.00
R6417:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6420:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6421:Scn1a	UTSW	2	66272927	missense	probably damaging	1.00
R6461:Scn1a	UTSW	2	66326122	missense	probably null	0.01
R6701:Scn1a	UTSW	2	66337960	missense	probably damaging	0.99
R6717:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R6834:Scn1a	UTSW	2	66327742	missense	probably damaging	1.00
R6918:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R6953:Scn1a	UTSW	2	66319469	missense	probably damaging	1.00
R6996:Scn1a	UTSW	2	66287731	missense	probably damaging	1.00
R7022:Scn1a	UTSW	2	66317899	missense	probably damaging	1.00
R7109:Scn1a	UTSW	2	66350942	missense	possibly damaging	0.62
R7115:Scn1a	UTSW	2	66324618	nonsense	probably null
R7239:Scn1a	UTSW	2	66277656	splice site	probably null
R7434:Scn1a	UTSW	2	66273045	missense	probably benign
R7646:Scn1a	UTSW	2	66287758	missense	possibly damaging	0.93
R7711:Scn1a	UTSW	2	66303660	missense	probably benign
R7879:Scn1a	UTSW	2	66286005	nonsense	probably null
R7931:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
R7962:Scn1a	UTSW	2	66328442	missense	probably damaging	1.00
R8025:Scn1a	UTSW	2	66318213	missense	probably benign	0.02
R8055:Scn1a	UTSW	2	66319501	missense	probably damaging	1.00
R8095:Scn1a	UTSW	2	66302465	missense	possibly damaging	0.93
R8167:Scn1a	UTSW	2	66324838	missense	probably damaging	0.98
R8339:Scn1a	UTSW	2	66286029	missense	probably damaging	1.00
R8363:Scn1a	UTSW	2	66322257	missense	probably damaging	1.00
R8516:Scn1a	UTSW	2	66326134	missense	possibly damaging	0.79
Z1176:Scn1a	UTSW	2	66326128	missense	possibly damaging	0.92
Z1177:Scn1a	UTSW	2	66324952	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTCGACCAACCAGGAATCATTCTC -3'
(R):5'- GTTCTCCCCAAGACGCAATAGCAG -3'

Sequencing Primer
(F):5'- GAATCATTCTCAAGAGTTCCATTCTG -3'
(R):5'- CTGATGATGAACACAGCACCTTTG -3'

Posted On

2013-05-09