Incidental Mutation 'R4528:Timm10b'
ID332996
Institutional Source Beutler Lab
Gene Symbol Timm10b
Ensembl Gene ENSMUSG00000089847
Gene Nametranslocase of inner mitochondrial membrane 10B
SynonymsFxC1, Fracture Callus 1, Tim9b, Tim10b
MMRRC Submission 041769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4528 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105640056-105643637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105682806 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 828 (N828S)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106776] [ENSMUST00000142874] [ENSMUST00000145988]
Predicted Effect probably benign
Transcript: ENSMUST00000106776
AA Change: N90S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102388
Gene: ENSMUSG00000030882
AA Change: N90S

DomainStartEndE-ValueType
low complexity region 205 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128388
Predicted Effect probably benign
Transcript: ENSMUST00000142874
Predicted Effect probably benign
Transcript: ENSMUST00000145988
AA Change: N828S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: N828S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FXC1, or TIMM10B, belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm A T 9: 53,500,759 I999K probably benign Het
Camsap3 A G 8: 3,606,515 E535G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpu G T 8: 46,562,422 G34* probably null Het
Col7a1 C A 9: 108,959,533 A739D unknown Het
Coro1b T C 19: 4,149,981 V107A probably benign Het
Cpeb3 T C 19: 37,139,088 D381G possibly damaging Het
Cyp2a22 T C 7: 26,934,769 D320G possibly damaging Het
Dcaf1 A T 9: 106,844,204 K398N probably damaging Het
Etfa A G 9: 55,500,050 S52P probably damaging Het
Fat4 T A 3: 38,891,294 H1445Q probably benign Het
Foxred2 T A 15: 77,943,249 M637L probably benign Het
Gbe1 A T 16: 70,478,337 I342L probably benign Het
Gm14410 G T 2: 177,193,941 H177N probably damaging Het
Gm14410 A T 2: 177,193,943 I176K probably benign Het
Gm1527 T A 3: 28,914,393 M198K probably damaging Het
Hr T C 14: 70,566,383 L838P probably damaging Het
Kmt2e T C 5: 23,473,558 S212P possibly damaging Het
Lims1 T C 10: 58,410,060 C180R probably damaging Het
Mki67 A T 7: 135,695,359 S2649T probably damaging Het
Olfr1308 T C 2: 111,960,948 N42D probably damaging Het
Olfr417 T A 1: 174,369,256 L113H probably damaging Het
Olfr574 A G 7: 102,948,806 M104V probably damaging Het
Pde4dip C T 3: 97,717,022 E1399K probably damaging Het
Pex1 T C 5: 3,631,712 Y1053H probably damaging Het
Plscr2 G A 9: 92,289,693 E113K possibly damaging Het
Pus1 T C 5: 110,774,730 Y309C probably damaging Het
Scube3 T A 17: 28,162,999 V333D possibly damaging Het
Serpina11 A T 12: 103,986,333 N66K probably benign Het
Thtpa T A 14: 55,095,582 D41E probably damaging Het
Tlr12 A C 4: 128,618,025 L144R probably damaging Het
Uba7 A G 9: 107,983,903 E964G possibly damaging Het
Ugt1a6b T A 1: 88,107,579 I213N probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zbtb43 A G 2: 33,462,325 probably benign Het
Zfp985 A T 4: 147,582,890 I72F possibly damaging Het
Zfpm1 G A 8: 122,335,642 R480H probably benign Het
Other mutations in Timm10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Timm10b APN 7 105641138 nonsense probably null
IGL02642:Timm10b APN 7 105668438 splice site probably benign
IGL02689:Timm10b APN 7 105640632 splice site probably benign
R0413:Timm10b UTSW 7 105678330 missense probably benign 0.11
R0635:Timm10b UTSW 7 105640688 intron probably benign
R1761:Timm10b UTSW 7 105683708 nonsense probably null
R4525:Timm10b UTSW 7 105682806 missense probably benign 0.00
R4527:Timm10b UTSW 7 105682806 missense probably benign 0.00
R4839:Timm10b UTSW 7 105684012 missense probably damaging 1.00
R5007:Timm10b UTSW 7 105641091 missense probably damaging 1.00
R5313:Timm10b UTSW 7 105641080 missense probably damaging 1.00
R5632:Timm10b UTSW 7 105641122 missense probably damaging 1.00
R7153:Timm10b UTSW 7 105640880 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGGATTTATCACAGTGAGAGCC -3'
(R):5'- AGAAGAGTGTGCTGAGCCTTTG -3'

Sequencing Primer
(F):5'- GATTTATCACAGTGAGAGCCCCCTG -3'
(R):5'- CTTTGTGCAGGCCAGGC -3'
Posted On2015-08-18