Mutagenetix > Incidental Mutations

Incidental Mutation 'R0107:Tlk1'

33300

Institutional Source

Beutler Lab

Gene Symbol

Tlk1

Ensembl Gene

ENSMUSG00000041997

Gene Name

tousled-like kinase 1

Synonyms

4930545J15Rik

MMRRC Submission

038393-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0107 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

70712407-70825728 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 70713989 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 767 (*767W)

Ref Sequence

ENSEMBL: ENSMUSP00000035961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038584] [ENSMUST00000133432]

Predicted Effect

probably null
Transcript: ENSMUST00000038584
AA Change: *767W

SMART Domains

Protein: ENSMUSP00000035961
Gene: ENSMUSG00000041997
AA Change: *767W

Domain	Start	End	E-Value	Type
low complexity region	20	33	N/A	INTRINSIC
low complexity region	68	85	N/A	INTRINSIC
low complexity region	170	192	N/A	INTRINSIC
coiled coil region	248	277	N/A	INTRINSIC
coiled coil region	403	441	N/A	INTRINSIC
S_TKc	456	734	4.41e-75	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133432

SMART Domains

Protein: ENSMUSP00000121549
Gene: ENSMUSG00000014959

Domain	Start	End	E-Value	Type
PDZ	5	75	8.14e-1	SMART
internal_repeat_1	107	196	1.1e-15	PROSPERO
low complexity region	236	252	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135128

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141707

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152738

Meta Mutation Damage Score

0.8819

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.6%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,080,834	V825A	probably benign	Het
Adamts7	T	C	9: 90,180,720	I409T	possibly damaging	Het
Adck1	T	C	12: 88,446,656	W253R	possibly damaging	Het
Afg3l2	A	G	18: 67,431,766	F213L	probably damaging	Het
Ankle2	T	C	5: 110,253,027	V743A	probably benign	Het
Ankrd34c	C	T	9: 89,729,484	R268H	probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc7b	T	G	8: 129,178,197		probably benign	Het
Cd320	A	T	17: 33,848,085	M169L	probably benign	Het
Chn1	A	G	2: 73,614,684	Y338H	probably damaging	Het
Chuk	T	A	19: 44,096,919	S263C	probably damaging	Het
Dennd4b	C	A	3: 90,272,736	P663T	possibly damaging	Het
Dnajc24	T	G	2: 106,001,914		probably benign	Het
Fam172a	A	G	13: 77,902,814	D145G	probably damaging	Het
Fbn2	A	G	18: 58,056,203	V1617A	probably benign	Het
Fermt2	T	C	14: 45,464,822	N502D	probably damaging	Het
Frrs1	A	T	3: 116,896,716	I3F	probably damaging	Het
Fut1	C	A	7: 45,618,846	Q20K	possibly damaging	Het
Gbf1	T	C	19: 46,284,828	V1709A	probably benign	Het
Gfra3	G	T	18: 34,711,306	H60Q	probably benign	Het
Gm10750	T	A	2: 149,016,053	M93L	unknown	Het
Gm5538	T	A	3: 59,752,316	L397I	possibly damaging	Het
Hmcn1	T	A	1: 150,587,015	I5124L	probably benign	Het
Hps3	A	C	3: 20,030,796	L76R	probably damaging	Het
Ifrd1	T	A	12: 40,214,081	Q105L	probably damaging	Het
Irs2	A	T	8: 11,004,691	V1247E	probably damaging	Het
Itgal	T	C	7: 127,328,559		probably benign	Het
Ivns1abp	A	T	1: 151,361,570	N495I	probably damaging	Het
Kank1	T	A	19: 25,430,366		probably benign	Het
Mroh8	T	C	2: 157,225,468	Q657R	probably benign	Het
Mthfd1l	T	C	10: 4,041,838	Y597H	probably benign	Het
Myom1	G	A	17: 71,077,365	V692I	probably damaging	Het
Olfr347	T	G	2: 36,734,718	Y132*	probably null	Het
Olfr45	A	T	7: 140,691,345	M147L	probably benign	Het
Olfr835	A	G	9: 19,035,333	D70G	probably damaging	Het
Palmd	A	T	3: 116,924,076	H257Q	probably damaging	Het
Pcnx2	A	T	8: 125,753,586	V1994D	probably benign	Het
Phkb	G	A	8: 86,016,931	G553S	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Ptprn	A	T	1: 75,255,712	L453M	probably damaging	Het
Ptprz1	T	A	6: 23,000,570	D886E	probably damaging	Het
Rcn1	T	A	2: 105,394,781	I110F	possibly damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Slc6a19	A	G	13: 73,684,057	Y467H	possibly damaging	Het
Slc9c1	T	A	16: 45,575,420	D611E	probably benign	Het
Slitrk6	T	C	14: 110,751,963	E104G	possibly damaging	Het
Spag17	A	T	3: 100,050,787	K920N	possibly damaging	Het
St3gal5	A	G	6: 72,142,149	S82G	probably benign	Het
Tln2	A	G	9: 67,370,706	V342A	probably damaging	Het
Tmem104	T	A	11: 115,202,180	M132K	probably damaging	Het
Tmem184c	A	G	8: 77,597,073	S387P	possibly damaging	Het
Tmtc1	A	G	6: 148,425,913	V34A	possibly damaging	Het
Trim46	A	G	3: 89,236,333	F596S	probably damaging	Het
Unc79	T	A	12: 103,134,525	D1870E	possibly damaging	Het
Utp20	T	C	10: 88,778,391	T1234A	probably benign	Het
Vmn1r31	T	A	6: 58,472,743	T46S	probably benign	Het
Vps13a	A	T	19: 16,691,824	L1341Q	probably benign	Het
Wdr72	A	T	9: 74,210,433	D821V	probably damaging	Het
Zfhx4	T	C	3: 5,398,982	L1400P	probably damaging	Het
Zfp217	T	A	2: 170,114,874	K735*	probably null	Het
Zfp235	A	G	7: 24,137,116	Q29R	probably damaging	Het
Zfp628	A	G	7: 4,920,168	Y463C	probably damaging	Het
Zkscan4	A	G	13: 21,484,581	T401A	possibly damaging	Het

Other mutations in Tlk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00673:Tlk1	APN	2	70745516	missense	probably damaging	1.00
IGL01087:Tlk1	APN	2	70752316	missense	possibly damaging	0.64
IGL01514:Tlk1	APN	2	70752266	missense	probably benign	0.00
IGL02976:Tlk1	APN	2	70721591	nonsense	probably null
IGL03024:Tlk1	APN	2	70746036	nonsense	probably null
Aku-aku	UTSW	2	70738445	missense	probably damaging	0.98
Heyerdahl	UTSW	2	70738426	nonsense	probably null
K3955:Tlk1	UTSW	2	70721701	missense	possibly damaging	0.85
R0226:Tlk1	UTSW	2	70714169	unclassified	probably benign
R0332:Tlk1	UTSW	2	70745565	splice site	probably null
R0601:Tlk1	UTSW	2	70714158	missense	probably benign	0.44
R1739:Tlk1	UTSW	2	70721077	missense	probably damaging	1.00
R2080:Tlk1	UTSW	2	70738445	missense	probably damaging	0.98
R2422:Tlk1	UTSW	2	70770005	missense	probably damaging	1.00
R3843:Tlk1	UTSW	2	70749327	missense	probably benign	0.05
R3970:Tlk1	UTSW	2	70716652	missense	probably damaging	1.00
R4191:Tlk1	UTSW	2	70725547	missense	probably damaging	1.00
R4867:Tlk1	UTSW	2	70721571	nonsense	probably null
R5022:Tlk1	UTSW	2	70742065	missense	probably benign	0.10
R5275:Tlk1	UTSW	2	70752205	intron	probably benign
R5469:Tlk1	UTSW	2	70721668	missense	probably benign	0.15
R6531:Tlk1	UTSW	2	70742083	missense	probably benign	0.00
R6592:Tlk1	UTSW	2	70714153	missense	probably damaging	1.00
R6797:Tlk1	UTSW	2	70738426	nonsense	probably null
R7030:Tlk1	UTSW	2	70721928	missense	probably damaging	1.00
R7705:Tlk1	UTSW	2	70786672	splice site	probably null
R7970:Tlk1	UTSW	2	70752300	missense	possibly damaging	0.64
R8284:Tlk1	UTSW	2	70714021	missense	probably benign
X0028:Tlk1	UTSW	2	70746031	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATGGTATTCCTGTTTCGTGCTGC -3'
(R):5'- CTGATTGAGCCTATGATGTGCCCG -3'

Sequencing Primer
(F):5'- TGCTCCAGGGCAGTGAG -3'
(R):5'- AAAGCTGACCTGTCTGTAGTC -3'

Posted On

2013-05-09