Incidental Mutation 'R4528:Plscr2'
ID333003
Institutional Source Beutler Lab
Gene Symbol Plscr2
Ensembl Gene ENSMUSG00000032372
Gene Namephospholipid scramblase 2
SynonymsPL scramblase
MMRRC Submission 041769-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4528 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location92275602-92297752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92289693 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 113 (E113K)
Ref Sequence ENSEMBL: ENSMUSP00000136481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034932] [ENSMUST00000113044] [ENSMUST00000180154]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034932
AA Change: E113K

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034932
Gene: ENSMUSG00000032372
AA Change: E113K

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
Pfam:Scramblase 84 305 5.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113044
SMART Domains Protein: ENSMUSP00000108667
Gene: ENSMUSG00000032372

DomainStartEndE-ValueType
Pfam:Scramblase 1 170 5.8e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156772
Predicted Effect possibly damaging
Transcript: ENSMUST00000180154
AA Change: E113K

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136481
Gene: ENSMUSG00000032372
AA Change: E113K

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
Pfam:Scramblase 84 305 5.1e-94 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm A T 9: 53,500,759 I999K probably benign Het
Camsap3 A G 8: 3,606,515 E535G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpu G T 8: 46,562,422 G34* probably null Het
Col7a1 C A 9: 108,959,533 A739D unknown Het
Coro1b T C 19: 4,149,981 V107A probably benign Het
Cpeb3 T C 19: 37,139,088 D381G possibly damaging Het
Cyp2a22 T C 7: 26,934,769 D320G possibly damaging Het
Dcaf1 A T 9: 106,844,204 K398N probably damaging Het
Etfa A G 9: 55,500,050 S52P probably damaging Het
Fat4 T A 3: 38,891,294 H1445Q probably benign Het
Foxred2 T A 15: 77,943,249 M637L probably benign Het
Gbe1 A T 16: 70,478,337 I342L probably benign Het
Gm14410 G T 2: 177,193,941 H177N probably damaging Het
Gm14410 A T 2: 177,193,943 I176K probably benign Het
Gm1527 T A 3: 28,914,393 M198K probably damaging Het
Hr T C 14: 70,566,383 L838P probably damaging Het
Kmt2e T C 5: 23,473,558 S212P possibly damaging Het
Lims1 T C 10: 58,410,060 C180R probably damaging Het
Mki67 A T 7: 135,695,359 S2649T probably damaging Het
Olfr1308 T C 2: 111,960,948 N42D probably damaging Het
Olfr417 T A 1: 174,369,256 L113H probably damaging Het
Olfr574 A G 7: 102,948,806 M104V probably damaging Het
Pde4dip C T 3: 97,717,022 E1399K probably damaging Het
Pex1 T C 5: 3,631,712 Y1053H probably damaging Het
Pus1 T C 5: 110,774,730 Y309C probably damaging Het
Scube3 T A 17: 28,162,999 V333D possibly damaging Het
Serpina11 A T 12: 103,986,333 N66K probably benign Het
Thtpa T A 14: 55,095,582 D41E probably damaging Het
Timm10b A G 7: 105,682,806 N828S probably benign Het
Tlr12 A C 4: 128,618,025 L144R probably damaging Het
Uba7 A G 9: 107,983,903 E964G possibly damaging Het
Ugt1a6b T A 1: 88,107,579 I213N probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zbtb43 A G 2: 33,462,325 probably benign Het
Zfp985 A T 4: 147,582,890 I72F possibly damaging Het
Zfpm1 G A 8: 122,335,642 R480H probably benign Het
Other mutations in Plscr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Plscr2 APN 9 92290632 splice site probably benign
IGL02496:Plscr2 APN 9 92289663 missense probably benign 0.12
R0401:Plscr2 UTSW 9 92282135 missense probably benign
R0620:Plscr2 UTSW 9 92287654 missense probably benign 0.10
R0879:Plscr2 UTSW 9 92287793 missense probably damaging 1.00
R1829:Plscr2 UTSW 9 92290755 missense probably damaging 1.00
R2022:Plscr2 UTSW 9 92295594 missense probably damaging 1.00
R2237:Plscr2 UTSW 9 92290824 missense probably damaging 1.00
R2971:Plscr2 UTSW 9 92290671 nonsense probably null
R3552:Plscr2 UTSW 9 92290795 missense probably damaging 1.00
R3762:Plscr2 UTSW 9 92291080 missense probably damaging 1.00
R4214:Plscr2 UTSW 9 92287737 missense probably benign 0.09
R4679:Plscr2 UTSW 9 92287770 missense probably benign 0.13
R4708:Plscr2 UTSW 9 92291014 missense probably damaging 1.00
R4709:Plscr2 UTSW 9 92291014 missense probably damaging 1.00
R4831:Plscr2 UTSW 9 92291077 missense possibly damaging 0.89
R5244:Plscr2 UTSW 9 92291049 missense probably benign 0.33
R6102:Plscr2 UTSW 9 92287668 missense probably benign 0.32
R6298:Plscr2 UTSW 9 92290719 missense probably benign 0.05
R6893:Plscr2 UTSW 9 92290704 missense probably benign 0.05
R7320:Plscr2 UTSW 9 92291140 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAATCAATCTTGTCTTCTGGAAAGA -3'
(R):5'- CCTACTTCTCAGAATTGGACAGGAGAT -3'

Sequencing Primer
(F):5'- GCAGTCAGTGTTCTTAACCACTGAG -3'
(R):5'- CTCAGAATTGGACAGGAGATAACATC -3'
Posted On2015-08-18