Incidental Mutation 'R4529:Pou3f3'
ID333017
Institutional Source Beutler Lab
Gene Symbol Pou3f3
Ensembl Gene ENSMUSG00000045515
Gene NamePOU domain, class 3, transcription factor 3
SynonymsOtf8, Brn1, Brn-1
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4529 (G1)
Quality Score221
Status Not validated
Chromosome1
Chromosomal Location42695768-42703176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42698554 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 470 (T470K)
Ref Sequence ENSEMBL: ENSMUSP00000052088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054883]
Predicted Effect probably benign
Transcript: ENSMUST00000054883
AA Change: T470K

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052088
Gene: ENSMUSG00000045515
AA Change: T470K

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
low complexity region 132 146 N/A INTRINSIC
low complexity region 162 206 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 235 250 N/A INTRINSIC
low complexity region 269 301 N/A INTRINSIC
POU 311 385 9.06e-54 SMART
HOX 403 465 3.91e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199521
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a POU-domain containing protein that functions as a transcription factor. The encoded protein recognizes an octamer sequence in the DNA of target genes. This protein may play a role in development of the nervous system. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in death within 36 hours after birth. Mutant brains exhibit disorganized cells in the hippocampus and adjacent transitional cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Pou3f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Pou3f3 APN 1 42698526 missense probably benign 0.05
R0800:Pou3f3 UTSW 1 42698367 missense probably damaging 1.00
R2314:Pou3f3 UTSW 1 42698491 missense probably damaging 1.00
R4391:Pou3f3 UTSW 1 42697458 missense unknown
R5233:Pou3f3 UTSW 1 42698278 missense probably benign 0.17
R6536:Pou3f3 UTSW 1 42698214 missense probably damaging 1.00
R7750:Pou3f3 UTSW 1 42698148 missense probably damaging 1.00
R7936:Pou3f3 UTSW 1 42697400 missense unknown
Predicted Primers PCR Primer
(F):5'- TCGAGGTTAGCGTCAAAGG -3'
(R):5'- AAAGAGTCTCATCGGTCTCCAG -3'

Sequencing Primer
(F):5'- TTAGCGTCAAAGGCGCGC -3'
(R):5'- CGTGGCACGCCTGTCTTTG -3'
Posted On2015-08-18