Incidental Mutation 'R4529:Plekhm3'
ID333018
Institutional Source Beutler Lab
Gene Symbol Plekhm3
Ensembl Gene ENSMUSG00000051344
Gene Namepleckstrin homology domain containing, family M, member 3
Synonyms9430067K14Rik, A230102O09Rik, Plekhm1l
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R4529 (G1)
Quality Score187
Status Not validated
Chromosome1
Chromosomal Location64785983-64956824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64937825 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 162 (V162A)
Ref Sequence ENSEMBL: ENSMUSP00000138002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097713] [ENSMUST00000123225] [ENSMUST00000139649]
Predicted Effect probably benign
Transcript: ENSMUST00000097713
AA Change: V162A

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095320
Gene: ENSMUSG00000051344
AA Change: V162A

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123225
Predicted Effect probably benign
Transcript: ENSMUST00000139649
AA Change: V162A

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138002
Gene: ENSMUSG00000051344
AA Change: V162A

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181350
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Plekhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Plekhm3 APN 1 64921832 missense probably damaging 1.00
IGL01732:Plekhm3 APN 1 64922248 missense probably benign 0.44
IGL02422:Plekhm3 APN 1 64921866 nonsense probably null
IGL02724:Plekhm3 APN 1 64795117 missense probably damaging 0.97
IGL03226:Plekhm3 APN 1 64921800 missense possibly damaging 0.58
IGL03250:Plekhm3 APN 1 64938047 missense possibly damaging 0.65
R0124:Plekhm3 UTSW 1 64921751 missense probably damaging 0.99
R1336:Plekhm3 UTSW 1 64937781 small deletion probably benign
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1560:Plekhm3 UTSW 1 64937817 missense probably benign 0.03
R1901:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2328:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2432:Plekhm3 UTSW 1 64937856 missense probably damaging 1.00
R2568:Plekhm3 UTSW 1 64937781 small deletion probably benign
R3023:Plekhm3 UTSW 1 64937781 small deletion probably benign
R4496:Plekhm3 UTSW 1 64861236 missense probably damaging 1.00
R4682:Plekhm3 UTSW 1 64937927 missense possibly damaging 0.94
R4969:Plekhm3 UTSW 1 64937919 missense probably damaging 1.00
R5347:Plekhm3 UTSW 1 64819990 missense probably damaging 1.00
R5553:Plekhm3 UTSW 1 64921886 missense possibly damaging 0.89
R5583:Plekhm3 UTSW 1 64937986 nonsense probably null
R5953:Plekhm3 UTSW 1 64937895 missense probably damaging 0.98
R6319:Plekhm3 UTSW 1 64921934 missense probably benign 0.20
R6970:Plekhm3 UTSW 1 64892753 missense possibly damaging 0.80
R7014:Plekhm3 UTSW 1 64883270 missense probably damaging 1.00
R7408:Plekhm3 UTSW 1 64937984 missense probably benign 0.02
R7570:Plekhm3 UTSW 1 64937906 missense probably damaging 1.00
R7663:Plekhm3 UTSW 1 64883208 missense probably damaging 0.98
R7719:Plekhm3 UTSW 1 64921742 missense probably benign 0.33
R7894:Plekhm3 UTSW 1 64921715 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATCCATATGTGGGTACTGGAG -3'
(R):5'- AGCCCCAGATAATCTTTCCTGG -3'

Sequencing Primer
(F):5'- CCATATGTGGGTACTGGAGAGTCAG -3'
(R):5'- CAGATAATCTTTCCTGGATGGCAC -3'
Posted On2015-08-18