Incidental Mutation 'R0107:Rcn1'
ID33302
Institutional Source Beutler Lab
Gene Symbol Rcn1
Ensembl Gene ENSMUSG00000005973
Gene Namereticulocalbin 1
SynonymsRcn
MMRRC Submission 038393-MU
Accession Numbers

Ncbi RefSeq: NM_009037.2; MGI:104559

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0107 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location105386291-105399319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105394781 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 110 (I110F)
Ref Sequence ENSEMBL: ENSMUSP00000006128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006128]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006128
AA Change: I110F

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006128
Gene: ENSMUSG00000005973
AA Change: I110F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EFh 77 105 1.45e0 SMART
EFh 113 141 6.56e0 SMART
Blast:EFh 164 192 3e-9 BLAST
EFh 201 229 4.35e-2 SMART
Pfam:EF-hand_5 244 267 1.6e-4 PFAM
Blast:EFh 278 306 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127019
Meta Mutation Damage Score 0.1303 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Reticulocalbin 1 is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. High conservation of amino acid residues outside of these motifs, in comparison to mouse reticulocalbin, is consistent with a possible biochemical function besides that of calcium binding. In human endothelial and prostate cancer cell lines this protein localizes to the plasma membrane.[provided by RefSeq, Jan 2009]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Rcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Rcn1 APN 2 105394829 missense possibly damaging 0.83
IGL02347:Rcn1 APN 2 105399126 missense probably benign 0.17
californianus UTSW 2 105388975 critical splice donor site probably null
gymnogyps UTSW 2 105389173 missense probably benign 0.06
P0031:Rcn1 UTSW 2 105389069 nonsense probably null
R1510:Rcn1 UTSW 2 105389089 missense probably damaging 1.00
R1699:Rcn1 UTSW 2 105399005 missense probably damaging 1.00
R4027:Rcn1 UTSW 2 105399050 nonsense probably null
R4028:Rcn1 UTSW 2 105399050 nonsense probably null
R4029:Rcn1 UTSW 2 105399050 nonsense probably null
R4923:Rcn1 UTSW 2 105389173 missense probably benign 0.06
R4956:Rcn1 UTSW 2 105394776 nonsense probably null
R5079:Rcn1 UTSW 2 105399057 missense probably damaging 0.96
R5333:Rcn1 UTSW 2 105389126 missense probably benign 0.00
R5709:Rcn1 UTSW 2 105394783 missense probably damaging 1.00
R6160:Rcn1 UTSW 2 105392017 missense probably damaging 1.00
R6525:Rcn1 UTSW 2 105388975 critical splice donor site probably null
R7111:Rcn1 UTSW 2 105389014 missense probably damaging 1.00
R7388:Rcn1 UTSW 2 105391991 missense probably damaging 0.98
R7974:Rcn1 UTSW 2 105393710 missense probably benign 0.32
R8515:Rcn1 UTSW 2 105389119 missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- CAGTGACCTTGTTCTCCACAGTGC -3'
(R):5'- ATCTCCAGAGTCCTGAGCTGAGAAG -3'

Sequencing Primer
(F):5'- TGTTCTCCACAGTGCAATCTC -3'
(R):5'- gctgagaagaattcagagttcc -3'
Posted On2013-05-09