Incidental Mutation 'R4529:Parp1'
ID333020
Institutional Source Beutler Lab
Gene Symbol Parp1
Ensembl Gene ENSMUSG00000026496
Gene Namepoly (ADP-ribose) polymerase family, member 1
SynonymsAdprp, 5830444G22Rik, PARP, sPARP-1, parp-1, Adprt1
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location180568924-180601254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180591312 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 679 (V679E)
Ref Sequence ENSEMBL: ENSMUSP00000027777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027777]
Predicted Effect probably damaging
Transcript: ENSMUST00000027777
AA Change: V679E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027777
Gene: ENSMUSG00000026496
AA Change: V679E

DomainStartEndE-ValueType
zf-PARP 12 90 4.73e-36 SMART
zf-PARP 116 200 3.99e-34 SMART
low complexity region 221 234 N/A INTRINSIC
PADR1 280 333 1.48e-28 SMART
low complexity region 359 378 N/A INTRINSIC
BRCT 388 467 9.62e-7 SMART
low complexity region 494 512 N/A INTRINSIC
WGR 553 633 2.36e-31 SMART
Pfam:PARP_reg 663 794 4e-54 PFAM
Pfam:PARP 797 1007 6.4e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192411
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous ablation of this gene may lead to skin hyperplasia, extreme sensitivity to radiation and alkylating agents, abnormal response to xenobiotics and endogenous compounds, reduced noise-induced hearing loss, altered susceptibility to neurotoxicity,or protection against renal ischemic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Parp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Parp1 APN 1 180589580 missense probably damaging 0.99
IGL01316:Parp1 APN 1 180592935 splice site probably benign
IGL01915:Parp1 APN 1 180598342 missense probably damaging 1.00
IGL02016:Parp1 APN 1 180598951 splice site probably null
IGL03328:Parp1 APN 1 180599590 splice site probably benign
IGL03348:Parp1 APN 1 180577707 splice site probably benign
IGL03368:Parp1 APN 1 180580622 missense probably benign 0.01
R0541:Parp1 UTSW 1 180599051 missense probably benign 0.05
R0648:Parp1 UTSW 1 180600440 splice site probably benign
R1326:Parp1 UTSW 1 180600458 missense probably damaging 1.00
R1421:Parp1 UTSW 1 180600088 splice site probably benign
R1438:Parp1 UTSW 1 180591242 missense probably benign 0.08
R1781:Parp1 UTSW 1 180588013 missense probably benign 0.04
R1800:Parp1 UTSW 1 180600526 splice site probably null
R1900:Parp1 UTSW 1 180597339 missense probably damaging 0.98
R1903:Parp1 UTSW 1 180588670 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2873:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2874:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R4342:Parp1 UTSW 1 180587329 missense probably benign 0.00
R4510:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4511:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4740:Parp1 UTSW 1 180589468 missense probably damaging 0.99
R4876:Parp1 UTSW 1 180569035 start codon destroyed probably null 1.00
R6666:Parp1 UTSW 1 180585951 missense probably benign
R6766:Parp1 UTSW 1 180598362 missense probably damaging 1.00
R6918:Parp1 UTSW 1 180588670 missense possibly damaging 0.46
R6974:Parp1 UTSW 1 180589506 nonsense probably null
R6996:Parp1 UTSW 1 180587371 missense possibly damaging 0.46
R7034:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7036:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7068:Parp1 UTSW 1 180588668 missense probably damaging 1.00
R7156:Parp1 UTSW 1 180599064 missense possibly damaging 0.91
R7326:Parp1 UTSW 1 180569100 missense possibly damaging 0.94
R7603:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7733:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7772:Parp1 UTSW 1 180589398 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCCAGGATTATGCCACACAC -3'
(R):5'- AGTACACTGCATGTCCCAC -3'

Sequencing Primer
(F):5'- GGATTATGCCACACACACTCTCTC -3'
(R):5'- CGACAGTGACTGGGCAAGC -3'
Posted On2015-08-18