Mutagenetix > Incidental Mutations

Incidental Mutation 'R4529:Akap9'

333025

Institutional Source

Beutler Lab

Gene Symbol

Akap9

Ensembl Gene

ENSMUSG00000040407

Gene Name

A kinase (PRKA) anchor protein (yotiao) 9

Synonyms

AKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12

MMRRC Submission

041592-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.521) question?

Stock #

R4529 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3928054-4081310 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4043948 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 2157 (F2157I)

Ref Sequence

ENSEMBL: ENSMUSP00000046129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044492]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044492
AA Change: F2157I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: F2157I

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
Blast:HPT	126	197	6e-21	BLAST
low complexity region	237	249	N/A	INTRINSIC
low complexity region	297	315	N/A	INTRINSIC
coiled coil region	404	593	N/A	INTRINSIC
coiled coil region	622	756	N/A	INTRINSIC
coiled coil region	777	843	N/A	INTRINSIC
coiled coil region	888	958	N/A	INTRINSIC
low complexity region	982	997	N/A	INTRINSIC
coiled coil region	1037	1065	N/A	INTRINSIC
low complexity region	1233	1246	N/A	INTRINSIC
internal_repeat_2	1247	1312	7.75e-5	PROSPERO
internal_repeat_1	1377	1485	2.63e-5	PROSPERO
coiled coil region	1522	1589	N/A	INTRINSIC
coiled coil region	1789	2107	N/A	INTRINSIC
coiled coil region	2132	2318	N/A	INTRINSIC
internal_repeat_1	2322	2445	2.63e-5	PROSPERO
coiled coil region	2455	2494	N/A	INTRINSIC
low complexity region	2587	2598	N/A	INTRINSIC
low complexity region	2627	2640	N/A	INTRINSIC
internal_repeat_2	2934	2997	7.75e-5	PROSPERO
low complexity region	3000	3016	N/A	INTRINSIC
coiled coil region	3109	3307	N/A	INTRINSIC
coiled coil region	3455	3493	N/A	INTRINSIC
coiled coil region	3521	3556	N/A	INTRINSIC
Pfam:PACT_coil_coil	3576	3657	1.2e-27	PFAM

Meta Mutation Damage Score

0.0978

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre1	A	G	17: 57,420,519	Y483C	possibly damaging	Het
Aldh1a3	T	C	7: 66,401,994	N404D	probably benign	Het
Ankrd2	A	T	19: 42,043,801	I231F	probably benign	Het
Apba1	A	G	19: 23,936,535	N641D	probably damaging	Het
C1qbp	T	C	11: 70,978,724	T178A	probably benign	Het
Chtf18	T	C	17: 25,720,618	Y64C	probably damaging	Het
Cyp1a1	A	G	9: 57,701,679	H281R	probably benign	Het
Ehmt2	A	G	17: 34,913,731	I1235V	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fcamr	A	G	1: 130,804,576	H44R	probably damaging	Het
Gm12185	T	C	11: 48,907,920	Y582C	probably damaging	Het
Gm12185	T	C	11: 48,908,094	N524S	possibly damaging	Het
Gm5460	A	C	14: 34,045,812	D459A	probably damaging	Het
H2-Q6	C	T	17: 35,425,844	T203I	probably null	Het
Inmt	T	C	6: 55,171,027	M206V	probably benign	Het
Khdc3	T	C	9: 73,104,019	S360P	possibly damaging	Het
Lin54	G	A	5: 100,446,560	T582I	possibly damaging	Het
Ltbp1	T	G	17: 75,151,360	V312G	probably benign	Het
Nlrp9a	T	C	7: 26,571,407	L899P	probably damaging	Het
Olfr786	T	C	10: 129,437,418	V202A	probably benign	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pappa	A	G	4: 65,231,182	I920V	probably benign	Het
Parp1	T	A	1: 180,591,312	V679E	probably damaging	Het
Pla2g4f	C	T	2: 120,300,619	R785Q	probably damaging	Het
Plbd1	T	A	6: 136,651,825	I82F	probably benign	Het
Plekhm3	A	G	1: 64,937,825	V162A	probably benign	Het
Plin4	A	G	17: 56,104,274	L919P	probably damaging	Het
Plxna4	C	T	6: 32,496,896		probably null	Het
Pou3f3	C	A	1: 42,698,554	T470K	probably benign	Het
Prss38	T	C	11: 59,373,499	Y214C	probably damaging	Het
Retreg1	T	A	15: 25,968,514	Y109N	probably damaging	Het
Slco1c1	A	G	6: 141,555,181	Y413C	probably damaging	Het
Stk32a	T	C	18: 43,242,979	C38R	possibly damaging	Het
Themis	T	C	10: 28,782,335	F453L	possibly damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tubgcp3	G	T	8: 12,663,932	L62I	probably damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Xpo7	G	A	14: 70,668,748	T986M	probably damaging	Het
Zfp51	C	T	17: 21,464,736	L538F	probably damaging	Het
Zfy1	A	G	Y: 726,511	L418S	possibly damaging	Het

Other mutations in Akap9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Akap9	APN	5	4046639	missense	probably damaging	0.97
IGL00642:Akap9	APN	5	3960842	missense	probably damaging	0.99
IGL00786:Akap9	APN	5	4070522	missense	probably damaging	1.00
IGL00788:Akap9	APN	5	4060480	missense	probably damaging	1.00
IGL00969:Akap9	APN	5	4001550	missense	probably benign
IGL01014:Akap9	APN	5	3968683	missense	probably benign	0.41
IGL01302:Akap9	APN	5	3970711	missense	probably benign	0.27
IGL01610:Akap9	APN	5	4032839	missense	possibly damaging	0.95
IGL01620:Akap9	APN	5	3960218	missense	probably benign	0.11
IGL01862:Akap9	APN	5	3951705	missense	probably damaging	0.99
IGL01862:Akap9	APN	5	4065856	missense	probably damaging	0.99
IGL02151:Akap9	APN	5	4032728	nonsense	probably null
IGL02635:Akap9	APN	5	4070500	missense	possibly damaging	0.59
IGL02858:Akap9	APN	5	4069130	missense	possibly damaging	0.88
IGL02967:Akap9	APN	5	3976164	missense	probably benign	0.07
IGL03064:Akap9	APN	5	3968755	missense	probably damaging	1.00
IGL03289:Akap9	APN	5	4077261	missense	probably damaging	1.00
Andy	UTSW	5	3961764	nonsense	probably null
blimey	UTSW	5	4070397	nonsense	probably null
marinarum	UTSW	5	4013875	nonsense	probably null
naviculus	UTSW	5	3960865	missense	probably damaging	0.98
wee_one	UTSW	5	4043925	missense	probably damaging	1.00
FR4449:Akap9	UTSW	5	3981214	unclassified	probably benign
PIT1430001:Akap9	UTSW	5	4029849	missense	probably damaging	1.00
PIT4366001:Akap9	UTSW	5	4046221	missense	probably benign	0.24
R0088:Akap9	UTSW	5	3961946	missense	probably benign	0.22
R0309:Akap9	UTSW	5	4069038	missense	probably benign	0.01
R0387:Akap9	UTSW	5	3951678	splice site	probably benign
R0440:Akap9	UTSW	5	4064569	missense	probably damaging	0.99
R0441:Akap9	UTSW	5	3961714	missense	probably benign	0.15
R0491:Akap9	UTSW	5	3972851	unclassified	probably benign
R0501:Akap9	UTSW	5	3970685	missense	probably damaging	1.00
R0507:Akap9	UTSW	5	4069043	missense	probably benign	0.41
R0544:Akap9	UTSW	5	4069185	missense	probably benign	0.22
R0581:Akap9	UTSW	5	4050620	missense	probably benign	0.03
R0611:Akap9	UTSW	5	3954870	missense	probably benign	0.00
R0620:Akap9	UTSW	5	4064136	missense	probably damaging	0.98
R0639:Akap9	UTSW	5	4060318	missense	probably damaging	1.00
R0932:Akap9	UTSW	5	4046492	missense	possibly damaging	0.77
R0944:Akap9	UTSW	5	4064742	splice site	probably null
R1101:Akap9	UTSW	5	4046205	missense	probably benign	0.00
R1159:Akap9	UTSW	5	3960865	missense	probably damaging	0.98
R1170:Akap9	UTSW	5	4055671	missense	probably benign
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1453:Akap9	UTSW	5	3975614	splice site	probably null
R1551:Akap9	UTSW	5	4069174	missense	probably benign	0.02
R1608:Akap9	UTSW	5	3961783	missense	probably damaging	1.00
R1652:Akap9	UTSW	5	4077210	missense	probably damaging	1.00
R1659:Akap9	UTSW	5	4064633	missense	probably damaging	1.00
R1713:Akap9	UTSW	5	4039345	critical splice donor site	probably null
R1719:Akap9	UTSW	5	3957645	nonsense	probably null
R1720:Akap9	UTSW	5	3972791	missense	possibly damaging	0.63
R1757:Akap9	UTSW	5	4001667	missense	probably benign	0.41
R1872:Akap9	UTSW	5	4001406	missense	probably damaging	1.00
R1876:Akap9	UTSW	5	3961809	missense	probably benign	0.28
R1881:Akap9	UTSW	5	4050173	missense	probably benign
R1950:Akap9	UTSW	5	3960677	missense	probably damaging	1.00
R1980:Akap9	UTSW	5	3972771	missense	probably damaging	0.99
R1993:Akap9	UTSW	5	4038520	splice site	probably null
R2008:Akap9	UTSW	5	3960131	missense	possibly damaging	0.47
R2020:Akap9	UTSW	5	3961967	missense	probably damaging	1.00
R2051:Akap9	UTSW	5	3975685	nonsense	probably null
R2061:Akap9	UTSW	5	3961010	missense	probably damaging	1.00
R2109:Akap9	UTSW	5	4044847	missense	possibly damaging	0.47
R2135:Akap9	UTSW	5	4064509	missense	probably damaging	1.00
R2225:Akap9	UTSW	5	4077271	missense	probably damaging	0.96
R2232:Akap9	UTSW	5	4046603	missense	probably damaging	1.00
R2424:Akap9	UTSW	5	4065279	missense	probably damaging	0.97
R2483:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R2879:Akap9	UTSW	5	3976353	intron	probably benign
R3622:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3623:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3624:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3722:Akap9	UTSW	5	4070351	missense	probably damaging	1.00
R3806:Akap9	UTSW	5	3954410	missense	probably benign	0.00
R3919:Akap9	UTSW	5	3961764	nonsense	probably null
R4023:Akap9	UTSW	5	3992077	missense	possibly damaging	0.66
R4093:Akap9	UTSW	5	4043996	missense	probably damaging	0.99
R4434:Akap9	UTSW	5	4032708	missense	probably damaging	0.99
R4530:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4532:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4533:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4585:Akap9	UTSW	5	3976151	missense	probably benign	0.00
R4586:Akap9	UTSW	5	3976151	missense	probably benign	0.00
R4655:Akap9	UTSW	5	4046403	missense	probably benign	0.14
R4676:Akap9	UTSW	5	4032774	missense	probably damaging	1.00
R4676:Akap9	UTSW	5	4064515	nonsense	probably null
R4724:Akap9	UTSW	5	4055339	missense	probably benign
R4731:Akap9	UTSW	5	3962266	missense	possibly damaging	0.54
R4732:Akap9	UTSW	5	4013901	missense	probably damaging	0.98
R4733:Akap9	UTSW	5	4013901	missense	probably damaging	0.98
R4743:Akap9	UTSW	5	3961013	missense	probably damaging	1.00
R4749:Akap9	UTSW	5	3968737	missense	probably benign	0.41
R4756:Akap9	UTSW	5	4001418	missense	probably damaging	0.99
R4757:Akap9	UTSW	5	4008382	missense	probably damaging	1.00
R4860:Akap9	UTSW	5	4034916	intron	probably benign
R4937:Akap9	UTSW	5	4050145	splice site	probably null
R4960:Akap9	UTSW	5	3957664	missense	probably benign	0.15
R4974:Akap9	UTSW	5	3961466	missense	possibly damaging	0.81
R5101:Akap9	UTSW	5	4001748	missense	probably damaging	0.96
R5160:Akap9	UTSW	5	4030007	missense	probably damaging	1.00
R5200:Akap9	UTSW	5	3960734	missense	probably benign	0.00
R5245:Akap9	UTSW	5	3976209	missense	probably damaging	0.99
R5293:Akap9	UTSW	5	3948687	missense	probably damaging	0.99
R5408:Akap9	UTSW	5	4058458	missense	possibly damaging	0.84
R5507:Akap9	UTSW	5	3968683	missense	probably benign	0.41
R5517:Akap9	UTSW	5	4001665	missense	possibly damaging	0.76
R5579:Akap9	UTSW	5	4064714	missense	possibly damaging	0.93
R5619:Akap9	UTSW	5	3954760	intron	probably benign
R5645:Akap9	UTSW	5	4050590	missense	probably benign	0.09
R5669:Akap9	UTSW	5	4050540	nonsense	probably null
R5686:Akap9	UTSW	5	3971926	missense	probably benign	0.00
R5697:Akap9	UTSW	5	3960170	missense	possibly damaging	0.92
R5821:Akap9	UTSW	5	4046064	missense	probably benign	0.13
R5875:Akap9	UTSW	5	4077285	missense	probably benign	0.01
R5897:Akap9	UTSW	5	4077904	missense	probably benign	0.23
R5999:Akap9	UTSW	5	4043925	missense	probably damaging	1.00
R6025:Akap9	UTSW	5	4032801	missense	probably damaging	1.00
R6078:Akap9	UTSW	5	4067924	critical splice donor site	probably null
R6138:Akap9	UTSW	5	4067924	critical splice donor site	probably null
R6225:Akap9	UTSW	5	3962105	missense	probably damaging	1.00
R6243:Akap9	UTSW	5	4065000	splice site	probably null
R6326:Akap9	UTSW	5	3962061	missense	probably damaging	1.00
R6564:Akap9	UTSW	5	4028491	missense	probably damaging	0.98
R6617:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R6625:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R6632:Akap9	UTSW	5	4013842	splice site	probably null
R6677:Akap9	UTSW	5	4029869	missense	probably benign	0.21
R6717:Akap9	UTSW	5	4064086	missense	probably damaging	1.00
R6893:Akap9	UTSW	5	3961709	missense	probably benign	0.32
R6915:Akap9	UTSW	5	3960551	missense	probably benign	0.03
R6938:Akap9	UTSW	5	4046628	missense	possibly damaging	0.91
R6972:Akap9	UTSW	5	4046699	missense	possibly damaging	0.62
R6973:Akap9	UTSW	5	4046699	missense	possibly damaging	0.62
R6993:Akap9	UTSW	5	4065866	missense	possibly damaging	0.65
R7032:Akap9	UTSW	5	3954896	missense	probably benign
R7164:Akap9	UTSW	5	4060364	missense	probably damaging	0.96
R7170:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7192:Akap9	UTSW	5	4005723	splice site	probably null
R7284:Akap9	UTSW	5	3956246	missense	probably damaging	1.00
R7299:Akap9	UTSW	5	4032696	missense	probably damaging	1.00
R7313:Akap9	UTSW	5	4004933	missense	probably damaging	1.00
R7326:Akap9	UTSW	5	4045930	missense	possibly damaging	0.47
R7343:Akap9	UTSW	5	4046364	missense	probably damaging	0.99
R7455:Akap9	UTSW	5	3972792	missense	probably benign	0.03
R7482:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7489:Akap9	UTSW	5	4004933	missense	probably damaging	1.00
R7525:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7528:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7576:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7577:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7578:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7610:Akap9	UTSW	5	3957677	missense	possibly damaging	0.95
R7658:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7754:Akap9	UTSW	5	4046736	missense	probably benign	0.03
R7818:Akap9	UTSW	5	4013875	nonsense	probably null
R7979:Akap9	UTSW	5	4050381	missense	probably benign
R7991:Akap9	UTSW	5	4064949	splice site	probably null
R8036:Akap9	UTSW	5	4070397	nonsense	probably null
R8054:Akap9	UTSW	5	4038707	critical splice donor site	probably null
R8116:Akap9	UTSW	5	4061183	missense	probably benign	0.04
R8150:Akap9	UTSW	5	3961982	missense	probably damaging	1.00
R8234:Akap9	UTSW	5	4044845	missense	probably benign	0.18
R8348:Akap9	UTSW	5	3948897	critical splice donor site	probably null
R8365:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R8366:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R8448:Akap9	UTSW	5	3948897	critical splice donor site	probably null
R8466:Akap9	UTSW	5	4038659	missense	probably damaging	1.00
U15987:Akap9	UTSW	5	4067924	critical splice donor site	probably null
X0026:Akap9	UTSW	5	4014039	missense	probably damaging	1.00
X0057:Akap9	UTSW	5	3975598	critical splice acceptor site	probably null
Z1176:Akap9	UTSW	5	3962251	missense	probably damaging	0.96
Z1177:Akap9	UTSW	5	4046189	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTTAAACATAACTTAGAAAGGCAT -3'
(R):5'- TAGGTTCAGTAGCAAACAGAAGTA -3'

Sequencing Primer
(F):5'- CTGTCTGACAGTAACATGG -3'
(R):5'- CTTGTAAATAAATCCCAGGGCTCGG -3'

Posted On

2015-08-18