Incidental Mutation 'R4529:Lin54'
ID333026
Institutional Source Beutler Lab
Gene Symbol Lin54
Ensembl Gene ENSMUSG00000035310
Gene Namelin-54 homolog (C. elegans)
Synonyms
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100441918-100500639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100446560 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 582 (T582I)
Ref Sequence ENSEMBL: ENSMUSP00000121902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046154] [ENSMUST00000123572] [ENSMUST00000137750] [ENSMUST00000139234] [ENSMUST00000144030] [ENSMUST00000149714] [ENSMUST00000152387] [ENSMUST00000154921]
Predicted Effect probably benign
Transcript: ENSMUST00000046154
AA Change: T671I

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041374
Gene: ENSMUSG00000035310
AA Change: T671I

DomainStartEndE-ValueType
low complexity region 364 382 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
CXC 520 560 3.06e-15 SMART
CXC 594 635 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123572
AA Change: T671I

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123425
Gene: ENSMUSG00000035310
AA Change: T671I

DomainStartEndE-ValueType
low complexity region 364 382 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
CXC 520 560 3.06e-15 SMART
CXC 594 635 1.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137750
AA Change: T450I

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120644
Gene: ENSMUSG00000035310
AA Change: T450I

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139234
SMART Domains Protein: ENSMUSP00000119322
Gene: ENSMUSG00000035310

DomainStartEndE-ValueType
low complexity region 218 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144030
Predicted Effect possibly damaging
Transcript: ENSMUST00000149714
AA Change: T450I

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123544
Gene: ENSMUSG00000035310
AA Change: T450I

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000152387
AA Change: T582I

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121902
Gene: ENSMUSG00000035310
AA Change: T582I

DomainStartEndE-ValueType
low complexity region 218 231 N/A INTRINSIC
low complexity region 275 293 N/A INTRINSIC
low complexity region 315 330 N/A INTRINSIC
CXC 431 471 3.06e-15 SMART
CXC 505 546 1.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154921
AA Change: T450I

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121137
Gene: ENSMUSG00000035310
AA Change: T450I

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Meta Mutation Damage Score 0.0888 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIN54 is a component of the LIN, or DREAM, complex, an essential regulator of cell cycle genes (Schmit et al., 2009 [PubMed 19725879]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Lin54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Lin54 APN 5 100485607 missense probably benign 0.03
IGL01356:Lin54 APN 5 100454017 missense probably damaging 0.98
IGL02931:Lin54 APN 5 100480321 missense possibly damaging 0.93
IGL03089:Lin54 APN 5 100450993 missense probably damaging 1.00
IGL03095:Lin54 APN 5 100454478 missense probably damaging 0.99
IGL03202:Lin54 APN 5 100475814 missense possibly damaging 0.92
R0505:Lin54 UTSW 5 100452293 missense probably damaging 0.98
R1138:Lin54 UTSW 5 100444134 missense probably damaging 0.98
R1540:Lin54 UTSW 5 100480250 missense probably damaging 0.99
R1719:Lin54 UTSW 5 100485249 missense possibly damaging 0.91
R1991:Lin54 UTSW 5 100485801 critical splice donor site probably null
R2698:Lin54 UTSW 5 100480250 missense probably damaging 0.99
R3738:Lin54 UTSW 5 100459806 splice site probably benign
R4238:Lin54 UTSW 5 100475744 missense possibly damaging 0.45
R4424:Lin54 UTSW 5 100446560 missense probably damaging 0.98
R4530:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4531:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4532:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4533:Lin54 UTSW 5 100485403 missense possibly damaging 0.79
R4665:Lin54 UTSW 5 100453084 missense possibly damaging 0.92
R4784:Lin54 UTSW 5 100459738 missense probably damaging 0.99
R4785:Lin54 UTSW 5 100459738 missense probably damaging 0.99
R5252:Lin54 UTSW 5 100480204 missense probably benign
R5265:Lin54 UTSW 5 100485519 missense probably damaging 1.00
R6545:Lin54 UTSW 5 100485137 unclassified probably null
R7150:Lin54 UTSW 5 100485300 missense possibly damaging 0.74
R7544:Lin54 UTSW 5 100485270 missense possibly damaging 0.84
X0025:Lin54 UTSW 5 100454443 missense probably benign 0.11
X0026:Lin54 UTSW 5 100450999 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTTTGTGGCTCAGTCTGGC -3'
(R):5'- TCTGTTGAGGAATCTACTTACTGTG -3'

Sequencing Primer
(F):5'- CTGGGAATTAAACTCAGGACCTTCG -3'
(R):5'- TCTGCTTTTGATTTGGAAACTTTTC -3'
Posted On2015-08-18