Incidental Mutation 'R4529:Nlrp9a'
ID333032
Institutional Source Beutler Lab
Gene Symbol Nlrp9a
Ensembl Gene ENSMUSG00000054102
Gene NameNLR family, pyrin domain containing 9A
SynonymsNalp9a, Nalp-theta, D7Ertd565e
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26535023-26575615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26571407 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 899 (L899P)
Ref Sequence ENSEMBL: ENSMUSP00000113318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071780] [ENSMUST00000108387] [ENSMUST00000117252] [ENSMUST00000122040] [ENSMUST00000153452]
Predicted Effect probably damaging
Transcript: ENSMUST00000071780
AA Change: L899P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071685
Gene: ENSMUSG00000054102
AA Change: L899P

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108387
AA Change: L954P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104024
Gene: ENSMUSG00000054102
AA Change: L954P

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 7.7e-33 PFAM
LRR 631 658 1.42e0 SMART
LRR 692 719 1.42e0 SMART
LRR 748 775 2.32e-1 SMART
LRR 777 804 3e0 SMART
LRR 805 832 1.12e-3 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.27e-4 SMART
LRR 891 918 2.02e2 SMART
LRR 919 946 6.24e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117252
AA Change: L842P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112398
Gene: ENSMUSG00000054102
AA Change: L842P

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 8.8e-34 PFAM
LRR 637 664 1.42e0 SMART
Blast:LRR 666 692 1e-5 BLAST
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.39e0 SMART
LRR 807 834 6.24e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122040
AA Change: L899P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113318
Gene: ENSMUSG00000054102
AA Change: L899P

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153452
SMART Domains Protein: ENSMUSP00000120498
Gene: ENSMUSG00000054102

DomainStartEndE-ValueType
Pfam:NACHT 54 222 6.9e-33 PFAM
LRR 542 569 1.42e0 SMART
LRR 603 630 1.42e0 SMART
Blast:LRR 632 657 1e-5 BLAST
LRR 659 686 2.32e-1 SMART
LRR 688 715 3e0 SMART
LRR 716 743 1.12e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Nlrp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Nlrp9a APN 7 26557625 missense probably benign 0.22
IGL00895:Nlrp9a APN 7 26558678 missense probably benign
IGL01081:Nlrp9a APN 7 26558094 missense possibly damaging 0.51
IGL01148:Nlrp9a APN 7 26557581 missense probably damaging 1.00
IGL01368:Nlrp9a APN 7 26557874 missense probably damaging 1.00
IGL01914:Nlrp9a APN 7 26557264 missense probably benign 0.01
IGL01952:Nlrp9a APN 7 26558019 missense probably benign 0.01
IGL02245:Nlrp9a APN 7 26557893 missense probably benign 0.02
IGL02449:Nlrp9a APN 7 26564971 missense probably benign 0.00
IGL02702:Nlrp9a APN 7 26564956 missense possibly damaging 0.67
IGL02944:Nlrp9a APN 7 26558651 missense probably benign 0.28
IGL03183:Nlrp9a APN 7 26557457 missense probably damaging 1.00
R0005:Nlrp9a UTSW 7 26573788 splice site probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0013:Nlrp9a UTSW 7 26571225 splice site probably null
R0086:Nlrp9a UTSW 7 26558547 missense probably damaging 0.98
R0659:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R1126:Nlrp9a UTSW 7 26560741 missense probably benign 0.12
R1500:Nlrp9a UTSW 7 26567891 missense probably benign 0.01
R1585:Nlrp9a UTSW 7 26558668 missense probably benign 0.41
R1594:Nlrp9a UTSW 7 26570507 nonsense probably null
R1968:Nlrp9a UTSW 7 26564941 missense probably benign 0.23
R1989:Nlrp9a UTSW 7 26573913 missense probably benign 0.24
R2057:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2058:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2059:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2188:Nlrp9a UTSW 7 26564929 missense probably damaging 1.00
R2318:Nlrp9a UTSW 7 26573852 missense probably damaging 0.98
R3110:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3112:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3237:Nlrp9a UTSW 7 26571385 nonsense probably null
R3545:Nlrp9a UTSW 7 26557332 missense probably benign 0.03
R3805:Nlrp9a UTSW 7 26564852 nonsense probably null
R4005:Nlrp9a UTSW 7 26558550 missense probably benign 0.02
R4057:Nlrp9a UTSW 7 26570646 missense probably benign 0.00
R4756:Nlrp9a UTSW 7 26557441 missense probably damaging 1.00
R4908:Nlrp9a UTSW 7 26550944 missense probably damaging 1.00
R4972:Nlrp9a UTSW 7 26570539 missense probably damaging 1.00
R4992:Nlrp9a UTSW 7 26557386 missense probably benign 0.00
R5042:Nlrp9a UTSW 7 26571278 missense probably damaging 1.00
R5224:Nlrp9a UTSW 7 26557292 missense probably benign 0.43
R5449:Nlrp9a UTSW 7 26557829 missense probably benign 0.04
R5644:Nlrp9a UTSW 7 26558568 missense possibly damaging 0.51
R5734:Nlrp9a UTSW 7 26570640 missense probably damaging 1.00
R5905:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R5978:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R6028:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R6066:Nlrp9a UTSW 7 26558085 missense probably benign 0.00
R6082:Nlrp9a UTSW 7 26567977 missense probably benign 0.41
R6171:Nlrp9a UTSW 7 26558763 missense possibly damaging 0.71
R6352:Nlrp9a UTSW 7 26557626 missense probably damaging 1.00
R6490:Nlrp9a UTSW 7 26550886 missense probably damaging 1.00
R6540:Nlrp9a UTSW 7 26557392 missense possibly damaging 0.88
R7039:Nlrp9a UTSW 7 26567942 missense probably benign 0.03
R7151:Nlrp9a UTSW 7 26557247 nonsense probably null
R7173:Nlrp9a UTSW 7 26558178 missense probably benign 0.00
R7214:Nlrp9a UTSW 7 26551038 missense probably damaging 0.98
R7226:Nlrp9a UTSW 7 26558724 missense probably benign 0.02
R7250:Nlrp9a UTSW 7 26558718 missense possibly damaging 0.78
R7293:Nlrp9a UTSW 7 26571269 missense probably damaging 1.00
R7492:Nlrp9a UTSW 7 26557656 missense probably damaging 0.99
R7586:Nlrp9a UTSW 7 26557296 missense possibly damaging 0.83
R7844:Nlrp9a UTSW 7 26562581 missense possibly damaging 0.82
R8073:Nlrp9a UTSW 7 26560835 missense probably damaging 0.98
R8136:Nlrp9a UTSW 7 26557253 missense probably benign 0.34
R8400:Nlrp9a UTSW 7 26565006 missense probably benign 0.02
R8415:Nlrp9a UTSW 7 26557500 missense probably benign
Z1176:Nlrp9a UTSW 7 26558229 missense probably damaging 1.00
Z1177:Nlrp9a UTSW 7 26557456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGAACTAGCACTAAACAG -3'
(R):5'- TGATATTCGGAGGAATCACCACC -3'

Sequencing Primer
(F):5'- CATGCTTCTGCTTATAGGTTAGAC -3'
(R):5'- AGGAATCACCACCAAAGGATG -3'
Posted On2015-08-18