Incidental Mutation 'R4529:Aldh1a3'
ID333033
Institutional Source Beutler Lab
Gene Symbol Aldh1a3
Ensembl Gene ENSMUSG00000015134
Gene Namealdehyde dehydrogenase family 1, subfamily A3
Synonymsretinaldehyde dehydrogenase 3, V1, RALDH3, ALDH6
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location66390890-66427517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66401994 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 404 (N404D)
Ref Sequence ENSEMBL: ENSMUSP00000015278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015278]
Predicted Effect probably benign
Transcript: ENSMUST00000015278
AA Change: N404D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015278
Gene: ENSMUSG00000015134
AA Change: N404D

DomainStartEndE-ValueType
Pfam:Aldedh 40 503 1.2e-188 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173756
Predicted Effect probably benign
Transcript: ENSMUST00000174701
SMART Domains Protein: ENSMUSP00000133370
Gene: ENSMUSG00000015134

DomainStartEndE-ValueType
Pfam:Aldedh 1 155 2.7e-55 PFAM
Pfam:Aldedh 151 277 1.7e-46 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aldehyde dehydrogenase enzyme that uses retinal as a substrate. Mutations in this gene have been associated with microphthalmia, isolated 8, and expression changes have also been detected in tumor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Nullizygous mice show neonatal death and persistent hyperplastic primary vitreous. Homozygotes for a null allele have choanal atresia, ethmoturbinal hypoplasia, ventral lens rotation, short ventral retina and no Harderian gland. Homozygotes for another allele show thick neural retina and no vitreum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Aldh1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Aldh1a3 APN 7 66409230 missense probably damaging 1.00
IGL01718:Aldh1a3 APN 7 66400205 missense possibly damaging 0.50
IGL02009:Aldh1a3 APN 7 66402041 missense probably benign 0.36
IGL02041:Aldh1a3 APN 7 66407831 missense probably damaging 1.00
IGL02680:Aldh1a3 APN 7 66406147 missense probably damaging 1.00
IGL02897:Aldh1a3 APN 7 66427327 missense probably benign 0.02
R0279:Aldh1a3 UTSW 7 66409252 missense probably benign 0.04
R0408:Aldh1a3 UTSW 7 66406050 missense probably damaging 1.00
R0633:Aldh1a3 UTSW 7 66400222 missense probably damaging 1.00
R0689:Aldh1a3 UTSW 7 66402005 missense probably benign 0.02
R0834:Aldh1a3 UTSW 7 66412910 missense probably benign 0.42
R1968:Aldh1a3 UTSW 7 66411500 critical splice donor site probably null
R2207:Aldh1a3 UTSW 7 66406021 missense probably damaging 1.00
R2519:Aldh1a3 UTSW 7 66422299 missense probably benign 0.00
R4975:Aldh1a3 UTSW 7 66419179 missense possibly damaging 0.78
R5138:Aldh1a3 UTSW 7 66407852 missense probably damaging 1.00
R5761:Aldh1a3 UTSW 7 66419179 missense probably damaging 0.96
R7186:Aldh1a3 UTSW 7 66406083 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTGCTACAGGCTTTGGG -3'
(R):5'- GCTGAGGGCCATTGAAAACAC -3'

Sequencing Primer
(F):5'- CTTTGGGGTTTGCCAAAAGC -3'
(R):5'- GTCCCCTCCTGGAAGAAAGTAG -3'
Posted On2015-08-18