Incidental Mutation 'R4529:Khdc3'
ID333038
Institutional Source Beutler Lab
Gene Symbol Khdc3
Ensembl Gene ENSMUSG00000092622
Gene NameKH domain containing 3, subcortical maternal complex member
Synonyms2410004A20Rik, FILIA, ecat1
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location73101836-73104438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73104019 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 360 (S360P)
Ref Sequence ENSEMBL: ENSMUSP00000132527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034737] [ENSMUST00000167514] [ENSMUST00000172578] [ENSMUST00000173734] [ENSMUST00000174203]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034737
AA Change: S384P

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034737
Gene: ENSMUSG00000092622
AA Change: S384P

DomainStartEndE-ValueType
Pfam:MOEP19 28 113 4.5e-34 PFAM
internal_repeat_1 117 217 6.81e-11 PROSPERO
internal_repeat_1 218 316 6.81e-11 PROSPERO
internal_repeat_2 275 397 3.62e-8 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000167514
AA Change: S360P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132527
Gene: ENSMUSG00000092622
AA Change: S360P

DomainStartEndE-ValueType
internal_repeat_1 117 212 2.21e-8 PROSPERO
internal_repeat_1 207 356 2.21e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000172578
SMART Domains Protein: ENSMUSP00000133850
Gene: ENSMUSG00000092622

DomainStartEndE-ValueType
PDB:3V69|B 1 75 4e-49 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000173734
SMART Domains Protein: ENSMUSP00000133915
Gene: ENSMUSG00000092622

DomainStartEndE-ValueType
internal_repeat_2 116 194 1.27e-8 PROSPERO
internal_repeat_1 117 231 1.6e-13 PROSPERO
internal_repeat_1 231 341 1.6e-13 PROSPERO
internal_repeat_2 267 344 1.27e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000174203
SMART Domains Protein: ENSMUSP00000134473
Gene: ENSMUSG00000092310

DomainStartEndE-ValueType
internal_repeat_1 116 173 5.47e-9 PROSPERO
internal_repeat_1 177 233 5.47e-9 PROSPERO
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the KHDC1 family, members of which contain an atypical KH domain that may not bind RNA like canonical KH domains. This gene is specifically expressed in the oocytes, and recent studies suggest that it may function as a regulator of genomic imprinting in the oocyte. Mutations in this gene are associated with recurrent biparental complete hydatidiform mole. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display a maternal effect defect in embryogenesis with delayed embryonic development and spindle abnormalities resulting in decreased litter sizes for homozygous females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Khdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02987:Khdc3 APN 9 73102666 missense possibly damaging 0.56
R1487:Khdc3 UTSW 9 73102564 missense probably benign 0.19
R1523:Khdc3 UTSW 9 73103491 missense possibly damaging 0.53
R1545:Khdc3 UTSW 9 73103660 missense probably benign 0.05
R1951:Khdc3 UTSW 9 73103237 missense possibly damaging 0.48
R2935:Khdc3 UTSW 9 73103705 missense possibly damaging 0.92
R3076:Khdc3 UTSW 9 73102930 missense probably damaging 1.00
R3880:Khdc3 UTSW 9 73103590 missense possibly damaging 0.73
R3899:Khdc3 UTSW 9 73104346 intron probably benign
R3900:Khdc3 UTSW 9 73104346 intron probably benign
R4224:Khdc3 UTSW 9 73102871 missense possibly damaging 0.92
R4412:Khdc3 UTSW 9 73102874 missense possibly damaging 0.93
R4647:Khdc3 UTSW 9 73102586 missense possibly damaging 0.81
R4648:Khdc3 UTSW 9 73102586 missense possibly damaging 0.81
R5153:Khdc3 UTSW 9 73103438 missense probably benign 0.18
R5261:Khdc3 UTSW 9 73103486 missense possibly damaging 0.92
R8362:Khdc3 UTSW 9 73103566 missense possibly damaging 0.96
X0024:Khdc3 UTSW 9 73103924 missense probably benign 0.01
X0026:Khdc3 UTSW 9 73102983 missense possibly damaging 0.95
X0066:Khdc3 UTSW 9 73104181 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTGGCTCCTGTGAAGGTC -3'
(R):5'- TGCAGACGTGTACCATCTATCC -3'

Sequencing Primer
(F):5'- TCCTGTGAAGGTCCACGAG -3'
(R):5'- TGGCTCACACCAGAGATGC -3'
Posted On2015-08-18