Incidental Mutation 'R4529:Olfr786'
ID333040
Institutional Source Beutler Lab
Gene Symbol Olfr786
Ensembl Gene ENSMUSG00000095696
Gene Nameolfactory receptor 786
SynonymsGA_x6K02T2PULF-11116958-11117896, MOR111-5
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129427306-129439080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129437418 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 202 (V202A)
Ref Sequence ENSEMBL: ENSMUSP00000145099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076508] [ENSMUST00000204529]
Predicted Effect probably benign
Transcript: ENSMUST00000076508
AA Change: V202A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000075827
Gene: ENSMUSG00000095696
AA Change: V202A

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 7.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204529
AA Change: V202A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145099
Gene: ENSMUSG00000095696
AA Change: V202A

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 7.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Olfr786
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Olfr786 APN 10 129437034 missense possibly damaging 0.95
IGL03027:Olfr786 APN 10 129436911 missense probably damaging 1.00
IGL03177:Olfr786 APN 10 129436815 start codon destroyed probably null 0.82
IGL03216:Olfr786 APN 10 129436937 missense probably damaging 0.98
IGL03265:Olfr786 APN 10 129436925 missense possibly damaging 0.83
R0080:Olfr786 UTSW 10 129437271 missense possibly damaging 0.85
R0082:Olfr786 UTSW 10 129437271 missense possibly damaging 0.85
R0242:Olfr786 UTSW 10 129437348 missense probably damaging 1.00
R0242:Olfr786 UTSW 10 129437348 missense probably damaging 1.00
R0507:Olfr786 UTSW 10 129437288 missense probably benign 0.00
R1432:Olfr786 UTSW 10 129436938 missense probably damaging 1.00
R1563:Olfr786 UTSW 10 129437711 missense probably benign
R2023:Olfr786 UTSW 10 129437582 missense probably damaging 0.99
R2142:Olfr786 UTSW 10 129437747 missense probably benign 0.14
R2279:Olfr786 UTSW 10 129437657 missense probably benign 0.07
R3412:Olfr786 UTSW 10 129437307 missense probably damaging 0.99
R4467:Olfr786 UTSW 10 129437064 missense probably benign 0.04
R4843:Olfr786 UTSW 10 129437447 missense probably benign 0.01
R4888:Olfr786 UTSW 10 129437379 missense possibly damaging 0.95
R4890:Olfr786 UTSW 10 129437079 missense probably benign 0.08
R6255:Olfr786 UTSW 10 129437688 missense possibly damaging 0.95
R6362:Olfr786 UTSW 10 129436943 missense probably damaging 1.00
R6705:Olfr786 UTSW 10 129437072 missense probably benign 0.00
R7270:Olfr786 UTSW 10 129437450 missense probably benign
R7450:Olfr786 UTSW 10 129437429 missense probably benign 0.00
R7803:Olfr786 UTSW 10 129436931 missense probably damaging 1.00
R7856:Olfr786 UTSW 10 129437016 missense probably damaging 1.00
X0052:Olfr786 UTSW 10 129437499 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAATGTTGGTCTTTGCCTCCTG -3'
(R):5'- GCAACTCCCTTGGTCAATGATG -3'

Sequencing Primer
(F):5'- GGCTGGTTTCTTTCCTAATCATC -3'
(R):5'- CAATGATGCTCTATCTGCTGCTGAG -3'
Posted On2015-08-18