Mutagenetix > Incidental Mutations

Incidental Mutation 'R4529:Gm12185'

333041

Institutional Source

Beutler Lab

Gene Symbol

Gm12185

Ensembl Gene

ENSMUSG00000048852

Gene Name

predicted gene 12185

Synonyms

MMRRC Submission

041592-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R4529 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48904656-48992226 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 48907920 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 582 (Y582C)

Ref Sequence

ENSEMBL: ENSMUSP00000092049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000094476]

Predicted Effect

probably damaging
Transcript: ENSMUST00000059930
AA Change: Y582C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852
AA Change: Y582C

Domain	Start	End	E-Value	Type
Pfam:IIGP	27	389	8.4e-123	PFAM
Pfam:MMR_HSR1	63	190	2.2e-9	PFAM
low complexity region	421	432	N/A	INTRINSIC
Pfam:IIGP	438	811	3.4e-152	PFAM
Pfam:MMR_HSR1	474	632	1.4e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000094476
AA Change: Y582C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092049
Gene: ENSMUSG00000048852
AA Change: Y582C

Domain	Start	End	E-Value	Type
Pfam:IIGP	27	389	1e-122	PFAM
Pfam:DLIC	43	98	3.2e-5	PFAM
Pfam:MMR_HSR1	63	187	6e-9	PFAM
low complexity region	421	432	N/A	INTRINSIC
Pfam:IIGP	438	811	8.9e-153	PFAM
Pfam:MMR_HSR1	474	615	2.6e-7	PFAM

Meta Mutation Damage Score

0.8507

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre1	A	G	17: 57,420,519	Y483C	possibly damaging	Het
Akap9	T	A	5: 4,043,948	F2157I	probably damaging	Het
Aldh1a3	T	C	7: 66,401,994	N404D	probably benign	Het
Ankrd2	A	T	19: 42,043,801	I231F	probably benign	Het
Apba1	A	G	19: 23,936,535	N641D	probably damaging	Het
C1qbp	T	C	11: 70,978,724	T178A	probably benign	Het
Chtf18	T	C	17: 25,720,618	Y64C	probably damaging	Het
Cyp1a1	A	G	9: 57,701,679	H281R	probably benign	Het
Ehmt2	A	G	17: 34,913,731	I1235V	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fcamr	A	G	1: 130,804,576	H44R	probably damaging	Het
Gm5460	A	C	14: 34,045,812	D459A	probably damaging	Het
H2-Q6	C	T	17: 35,425,844	T203I	probably null	Het
Inmt	T	C	6: 55,171,027	M206V	probably benign	Het
Khdc3	T	C	9: 73,104,019	S360P	possibly damaging	Het
Lin54	G	A	5: 100,446,560	T582I	possibly damaging	Het
Ltbp1	T	G	17: 75,151,360	V312G	probably benign	Het
Nlrp9a	T	C	7: 26,571,407	L899P	probably damaging	Het
Olfr786	T	C	10: 129,437,418	V202A	probably benign	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pappa	A	G	4: 65,231,182	I920V	probably benign	Het
Parp1	T	A	1: 180,591,312	V679E	probably damaging	Het
Pla2g4f	C	T	2: 120,300,619	R785Q	probably damaging	Het
Plbd1	T	A	6: 136,651,825	I82F	probably benign	Het
Plekhm3	A	G	1: 64,937,825	V162A	probably benign	Het
Plin4	A	G	17: 56,104,274	L919P	probably damaging	Het
Plxna4	C	T	6: 32,496,896		probably null	Het
Pou3f3	C	A	1: 42,698,554	T470K	probably benign	Het
Prss38	T	C	11: 59,373,499	Y214C	probably damaging	Het
Retreg1	T	A	15: 25,968,514	Y109N	probably damaging	Het
Slco1c1	A	G	6: 141,555,181	Y413C	probably damaging	Het
Stk32a	T	C	18: 43,242,979	C38R	possibly damaging	Het
Themis	T	C	10: 28,782,335	F453L	possibly damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tubgcp3	G	T	8: 12,663,932	L62I	probably damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Xpo7	G	A	14: 70,668,748	T986M	probably damaging	Het
Zfp51	C	T	17: 21,464,736	L538F	probably damaging	Het
Zfy1	A	G	Y: 726,511	L418S	possibly damaging	Het

Other mutations in Gm12185

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Gm12185	APN	11	48907222	missense	probably benign	0.01
IGL00495:Gm12185	APN	11	48907861	missense	probably damaging	0.99
IGL01763:Gm12185	APN	11	48915844	missense	probably benign	0.07
IGL01919:Gm12185	APN	11	48908059	missense	possibly damaging	0.90
IGL03388:Gm12185	APN	11	48908286	missense	probably benign	0.01
IGL03404:Gm12185	APN	11	48908037	missense	probably damaging	1.00
PIT4458001:Gm12185	UTSW	11	48907911	missense	probably damaging	1.00
R0347:Gm12185	UTSW	11	48915182	missense	probably benign	0.29
R0488:Gm12185	UTSW	11	48907839	missense	probably damaging	1.00
R1168:Gm12185	UTSW	11	48915355	missense	possibly damaging	0.60
R1223:Gm12185	UTSW	11	48907276	missense	probably damaging	0.98
R1417:Gm12185	UTSW	11	48907842	missense	probably damaging	1.00
R1468:Gm12185	UTSW	11	48915674	missense	possibly damaging	0.60
R1468:Gm12185	UTSW	11	48915674	missense	possibly damaging	0.60
R1519:Gm12185	UTSW	11	48907767	missense	probably damaging	1.00
R1558:Gm12185	UTSW	11	48915435	missense	probably damaging	0.99
R1630:Gm12185	UTSW	11	48907890	missense	probably benign	0.31
R1758:Gm12185	UTSW	11	48908032	missense	possibly damaging	0.82
R1793:Gm12185	UTSW	11	48915756	nonsense	probably null
R1908:Gm12185	UTSW	11	48915404	missense	probably benign	0.00
R1983:Gm12185	UTSW	11	48915356	missense	probably benign	0.01
R3917:Gm12185	UTSW	11	48915933	missense	probably benign	0.01
R3969:Gm12185	UTSW	11	48907345	missense	probably benign	0.03
R3970:Gm12185	UTSW	11	48907345	missense	probably benign	0.03
R4510:Gm12185	UTSW	11	48908478	missense	possibly damaging	0.84
R4511:Gm12185	UTSW	11	48908478	missense	possibly damaging	0.84
R4529:Gm12185	UTSW	11	48908094	missense	possibly damaging	0.66
R4532:Gm12185	UTSW	11	48907920	missense	probably damaging	1.00
R4532:Gm12185	UTSW	11	48908094	missense	possibly damaging	0.66
R4533:Gm12185	UTSW	11	48907920	missense	probably damaging	1.00
R4533:Gm12185	UTSW	11	48908094	missense	possibly damaging	0.66
R4678:Gm12185	UTSW	11	48915540	missense	probably benign	0.05
R5094:Gm12185	UTSW	11	48907548	missense	probably benign	0.35
R5238:Gm12185	UTSW	11	48908217	missense	possibly damaging	0.92
R5306:Gm12185	UTSW	11	48915555	missense	probably benign	0.03
R5371:Gm12185	UTSW	11	48915739	missense	probably benign	0.01
R5995:Gm12185	UTSW	11	48915713	missense	probably benign	0.40
R6113:Gm12185	UTSW	11	48915340	missense	possibly damaging	0.47
R6147:Gm12185	UTSW	11	48915890	missense	probably benign
R6160:Gm12185	UTSW	11	48908428	nonsense	probably null
R6247:Gm12185	UTSW	11	48915908	missense	probably damaging	0.98
R6264:Gm12185	UTSW	11	48916175	missense	probably benign	0.01
R6748:Gm12185	UTSW	11	48916296	missense	possibly damaging	0.53
R6765:Gm12185	UTSW	11	48915704	missense	probably benign	0.12
R6970:Gm12185	UTSW	11	48907912	nonsense	probably null
R7028:Gm12185	UTSW	11	48908244	missense	possibly damaging	0.80
R7033:Gm12185	UTSW	11	48915999	missense	probably benign
R7512:Gm12185	UTSW	11	48915890	missense	probably benign
R7609:Gm12185	UTSW	11	48916023	missense	possibly damaging	0.82
R7673:Gm12185	UTSW	11	48907628	missense	probably benign	0.45
Z1176:Gm12185	UTSW	11	48908086	missense	probably benign	0.21
Z1177:Gm12185	UTSW	11	48916302	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCATGAAGAGGTGGCGCTTG -3'
(R):5'- GACAATATGGGACCTGCCTG -3'

Sequencing Primer
(F):5'- TTTGGGAAGTCAAAGTCAGACACATC -3'
(R):5'- TGCCTGGCATTGGGTCAAC -3'

Posted On

2015-08-18