Incidental Mutation 'R4529:Gm12185'
ID333042
Institutional Source Beutler Lab
Gene Symbol Gm12185
Ensembl Gene ENSMUSG00000048852
Gene Namepredicted gene 12185
Synonyms
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48904656-48992226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48908094 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 524 (N524S)
Ref Sequence ENSEMBL: ENSMUSP00000092049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000094476]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059930
AA Change: N524S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852
AA Change: N524S

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094476
AA Change: N524S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092049
Gene: ENSMUSG00000048852
AA Change: N524S

DomainStartEndE-ValueType
Pfam:IIGP 27 389 1e-122 PFAM
Pfam:DLIC 43 98 3.2e-5 PFAM
Pfam:MMR_HSR1 63 187 6e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 8.9e-153 PFAM
Pfam:MMR_HSR1 474 615 2.6e-7 PFAM
Meta Mutation Damage Score 0.4090 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Gm12185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gm12185 APN 11 48907222 missense probably benign 0.01
IGL00495:Gm12185 APN 11 48907861 missense probably damaging 0.99
IGL01763:Gm12185 APN 11 48915844 missense probably benign 0.07
IGL01919:Gm12185 APN 11 48908059 missense possibly damaging 0.90
IGL03388:Gm12185 APN 11 48908286 missense probably benign 0.01
IGL03404:Gm12185 APN 11 48908037 missense probably damaging 1.00
PIT4458001:Gm12185 UTSW 11 48907911 missense probably damaging 1.00
R0347:Gm12185 UTSW 11 48915182 missense probably benign 0.29
R0488:Gm12185 UTSW 11 48907839 missense probably damaging 1.00
R1168:Gm12185 UTSW 11 48915355 missense possibly damaging 0.60
R1223:Gm12185 UTSW 11 48907276 missense probably damaging 0.98
R1417:Gm12185 UTSW 11 48907842 missense probably damaging 1.00
R1468:Gm12185 UTSW 11 48915674 missense possibly damaging 0.60
R1468:Gm12185 UTSW 11 48915674 missense possibly damaging 0.60
R1519:Gm12185 UTSW 11 48907767 missense probably damaging 1.00
R1558:Gm12185 UTSW 11 48915435 missense probably damaging 0.99
R1630:Gm12185 UTSW 11 48907890 missense probably benign 0.31
R1758:Gm12185 UTSW 11 48908032 missense possibly damaging 0.82
R1793:Gm12185 UTSW 11 48915756 nonsense probably null
R1908:Gm12185 UTSW 11 48915404 missense probably benign 0.00
R1983:Gm12185 UTSW 11 48915356 missense probably benign 0.01
R3917:Gm12185 UTSW 11 48915933 missense probably benign 0.01
R3969:Gm12185 UTSW 11 48907345 missense probably benign 0.03
R3970:Gm12185 UTSW 11 48907345 missense probably benign 0.03
R4510:Gm12185 UTSW 11 48908478 missense possibly damaging 0.84
R4511:Gm12185 UTSW 11 48908478 missense possibly damaging 0.84
R4529:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4532:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4532:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4533:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4533:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4678:Gm12185 UTSW 11 48915540 missense probably benign 0.05
R5094:Gm12185 UTSW 11 48907548 missense probably benign 0.35
R5238:Gm12185 UTSW 11 48908217 missense possibly damaging 0.92
R5306:Gm12185 UTSW 11 48915555 missense probably benign 0.03
R5371:Gm12185 UTSW 11 48915739 missense probably benign 0.01
R5995:Gm12185 UTSW 11 48915713 missense probably benign 0.40
R6113:Gm12185 UTSW 11 48915340 missense possibly damaging 0.47
R6147:Gm12185 UTSW 11 48915890 missense probably benign
R6160:Gm12185 UTSW 11 48908428 nonsense probably null
R6247:Gm12185 UTSW 11 48915908 missense probably damaging 0.98
R6264:Gm12185 UTSW 11 48916175 missense probably benign 0.01
R6748:Gm12185 UTSW 11 48916296 missense possibly damaging 0.53
R6765:Gm12185 UTSW 11 48915704 missense probably benign 0.12
R6970:Gm12185 UTSW 11 48907912 nonsense probably null
R7028:Gm12185 UTSW 11 48908244 missense possibly damaging 0.80
R7033:Gm12185 UTSW 11 48915999 missense probably benign
R7512:Gm12185 UTSW 11 48915890 missense probably benign
R7609:Gm12185 UTSW 11 48916023 missense possibly damaging 0.82
R7673:Gm12185 UTSW 11 48907628 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TATCTTGATCTATCTTGGTTCGGAC -3'
(R):5'- GACTGTGATTAGTCATGCTCTGC -3'

Sequencing Primer
(F):5'- TCTTGGTTCGGACAAAGTAGAAC -3'
(R):5'- TGCTCTGCGAAATATTGACAAAGCC -3'
Posted On2015-08-18