Incidental Mutation 'R4529:Prss38'
ID333043
Institutional Source Beutler Lab
Gene Symbol Prss38
Ensembl Gene ENSMUSG00000049291
Gene Nameprotease, serine 38
SynonymsGm249, LOC216797
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location59372669-59375657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59373499 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 214 (Y214C)
Ref Sequence ENSEMBL: ENSMUSP00000052010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061481]
Predicted Effect probably damaging
Transcript: ENSMUST00000061481
AA Change: Y214C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052010
Gene: ENSMUSG00000049291
AA Change: Y214C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 55 284 7.08e-75 SMART
low complexity region 288 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133698
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Prss38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03075:Prss38 APN 11 59373055 missense probably damaging 1.00
LCD18:Prss38 UTSW 11 59375641 utr 5 prime probably benign
R0001:Prss38 UTSW 11 59373180 splice site probably benign
R0097:Prss38 UTSW 11 59375608 missense possibly damaging 0.86
R0097:Prss38 UTSW 11 59375608 missense possibly damaging 0.86
R0540:Prss38 UTSW 11 59375543 missense possibly damaging 0.50
R0607:Prss38 UTSW 11 59375543 missense possibly damaging 0.50
R1966:Prss38 UTSW 11 59373484 missense probably damaging 1.00
R4394:Prss38 UTSW 11 59373028 missense probably damaging 1.00
R4397:Prss38 UTSW 11 59373028 missense probably damaging 1.00
R4738:Prss38 UTSW 11 59372945 missense probably benign 0.00
R5061:Prss38 UTSW 11 59374370 missense probably damaging 0.98
R5219:Prss38 UTSW 11 59375483 splice site probably benign
R5306:Prss38 UTSW 11 59372995 missense probably benign 0.00
R6894:Prss38 UTSW 11 59373024 missense probably benign 0.19
R7286:Prss38 UTSW 11 59375558 missense probably benign 0.00
R7860:Prss38 UTSW 11 59375170 missense probably damaging 1.00
T0970:Prss38 UTSW 11 59373148 missense possibly damaging 0.81
Z1176:Prss38 UTSW 11 59374334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAGAATGAGCGTCCATC -3'
(R):5'- AAGAATGTCTTTGCCTCCTTGC -3'

Sequencing Primer
(F):5'- TCAGCACTGAGGTCTGATACAAGC -3'
(R):5'- TTGCCTTCCAGGACTAAGAAAG -3'
Posted On2015-08-18