Incidental Mutation 'R4529:Retreg1'
ID333049
Institutional Source Beutler Lab
Gene Symbol Retreg1
Ensembl Gene ENSMUSG00000022270
Gene Namereticulophagy regulator 1
Synonyms1810015C04Rik, Fam134b
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location25843180-25973687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25968514 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 109 (Y109N)
Ref Sequence ENSEMBL: ENSMUSP00000154070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022881] [ENSMUST00000110438] [ENSMUST00000226438] [ENSMUST00000226750] [ENSMUST00000227275] [ENSMUST00000228306] [ENSMUST00000228327] [ENSMUST00000228600]
Predicted Effect probably damaging
Transcript: ENSMUST00000022881
AA Change: Y243N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022881
Gene: ENSMUSG00000022270
AA Change: Y243N

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110438
AA Change: Y119N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106068
Gene: ENSMUSG00000022270
AA Change: Y119N

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226438
AA Change: Y127N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226750
Predicted Effect probably damaging
Transcript: ENSMUST00000227275
AA Change: Y119N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228306
AA Change: Y109N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228327
AA Change: Y85N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000228600
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cis-Golgi transmembrane protein that may be necessary for the long-term survival of nociceptive and autonomic ganglion neurons. Mutations in this gene are a cause of hereditary sensory and autonomic neuropathy type IIB (HSAN IIB), and this gene may also play a role in susceptibility to vascular dementia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased thermal nociceptive threshold and sensory neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Retreg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Retreg1 APN 15 25966623 splice site probably null
IGL02548:Retreg1 APN 15 25895118 nonsense probably null
R0834:Retreg1 UTSW 15 25971670 missense probably benign 0.01
R1923:Retreg1 UTSW 15 25969838 missense probably damaging 1.00
R1965:Retreg1 UTSW 15 25970164 missense probably damaging 1.00
R4444:Retreg1 UTSW 15 25968444 splice site probably null
R4778:Retreg1 UTSW 15 25971785 missense possibly damaging 0.60
R5026:Retreg1 UTSW 15 25970128 missense probably damaging 1.00
R5103:Retreg1 UTSW 15 25968454 nonsense probably null
R6880:Retreg1 UTSW 15 25971739 missense probably damaging 1.00
R7275:Retreg1 UTSW 15 25971598 missense probably benign 0.44
R7357:Retreg1 UTSW 15 25971943 missense probably damaging 0.97
R7488:Retreg1 UTSW 15 25889542 missense
R7542:Retreg1 UTSW 15 25941210 start codon destroyed probably null 0.10
R7599:Retreg1 UTSW 15 25971641 missense probably benign 0.04
R7670:Retreg1 UTSW 15 25941040 intron probably benign
R8022:Retreg1 UTSW 15 25843479 missense
R8084:Retreg1 UTSW 15 25969799 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TAGCCGGGGACAGTGGTTATAG -3'
(R):5'- GCCATGCCCCATTTAGAAAC -3'

Sequencing Primer
(F):5'- GTGTACTTGATGAAGGGATAAACG -3'
(R):5'- TGCCCCATTTAGAAACATGCAC -3'
Posted On2015-08-18