Incidental Mutation 'R4529:H2-Q6'
ID333054
Institutional Source Beutler Lab
Gene Symbol H2-Q6
Ensembl Gene ENSMUSG00000073409
Gene Namehistocompatibility 2, Q region locus 6
Synonyms0610037M15Rik, Qa6, H-2Q6, Qa-6
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R4529 (G1)
Quality Score124
Status Not validated
Chromosome17
Chromosomal Location35424850-35430055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35425844 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 203 (T203I)
Ref Sequence ENSEMBL: ENSMUSP00000134550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113879] [ENSMUST00000174699]
Predicted Effect probably null
Transcript: ENSMUST00000113879
AA Change: T203I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109511
Gene: ENSMUSG00000073409
AA Change: T203I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 2.1e-92 PFAM
IGc1 219 290 7.68e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174699
AA Change: T203I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134550
Gene: ENSMUSG00000073409
AA Change: T203I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.1e-93 PFAM
IGc1 219 290 7.68e-23 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls a lymph node and splenic lymphocyte antigen detected by BALB/cBy anti-ORA1-a tumor antibody. The strain distribution for presence/absence of antigen varies widely among inbred strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in H2-Q6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:H2-Q6 APN 17 35425176 missense probably benign 0.06
PIT4508001:H2-Q6 UTSW 17 35425820 missense probably damaging 1.00
R0499:H2-Q6 UTSW 17 35425203 missense probably damaging 0.98
R2426:H2-Q6 UTSW 17 35424937 missense probably benign 0.06
R3236:H2-Q6 UTSW 17 35425700 missense probably damaging 0.99
R3237:H2-Q6 UTSW 17 35425700 missense probably damaging 0.99
R3810:H2-Q6 UTSW 17 35425781 missense probably damaging 1.00
R3827:H2-Q6 UTSW 17 35425679 missense probably damaging 1.00
R3932:H2-Q6 UTSW 17 35425566 splice site probably benign
R4030:H2-Q6 UTSW 17 35425816 missense probably benign 0.00
R4558:H2-Q6 UTSW 17 35428315 missense probably benign 0.00
R5100:H2-Q6 UTSW 17 35425320 missense probably benign 0.00
R5435:H2-Q6 UTSW 17 35425685 missense probably damaging 1.00
R5455:H2-Q6 UTSW 17 35424884 missense unknown
R5724:H2-Q6 UTSW 17 35425652 missense probably damaging 1.00
R6383:H2-Q6 UTSW 17 35428383 critical splice donor site probably null
R6752:H2-Q6 UTSW 17 35428127 missense probably damaging 0.96
R6853:H2-Q6 UTSW 17 35428359 makesense probably null
R7421:H2-Q6 UTSW 17 35425228 missense possibly damaging 0.94
R7558:H2-Q6 UTSW 17 35425619 missense probably benign
R7762:H2-Q6 UTSW 17 35428101 missense probably benign 0.01
X0057:H2-Q6 UTSW 17 35425593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAACGAAGACCTGAAAACCTG -3'
(R):5'- GCAGCTGTTGTTACCTCAGG -3'

Sequencing Primer
(F):5'- GACCTGAAAACCTGGACGGC -3'
(R):5'- CAGCTGTTGTTACCTCAGGGAAATTC -3'
Posted On2015-08-18