Incidental Mutation 'R4529:Stk32a'
ID333058
Institutional Source Beutler Lab
Gene Symbol Stk32a
Ensembl Gene ENSMUSG00000039954
Gene Nameserine/threonine kinase 32A
SynonymsYANK1, A930015B13Rik
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location43207697-43317481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43242979 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 38 (C38R)
Ref Sequence ENSEMBL: ENSMUSP00000038471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045477]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045477
AA Change: C38R

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038471
Gene: ENSMUSG00000039954
AA Change: C38R

DomainStartEndE-ValueType
S_TKc 23 281 9.58e-85 SMART
low complexity region 318 339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Stk32a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Stk32a APN 18 43310445 missense possibly damaging 0.46
IGL00704:Stk32a APN 18 43261249 missense probably damaging 1.00
IGL00813:Stk32a APN 18 43310520 missense probably benign 0.10
IGL02121:Stk32a APN 18 43313507 missense probably benign
IGL02407:Stk32a APN 18 43297511 missense probably benign 0.00
IGL02957:Stk32a APN 18 43311992 missense probably benign
R0004:Stk32a UTSW 18 43305056 missense probably damaging 1.00
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0288:Stk32a UTSW 18 43304995 splice site probably null
R0330:Stk32a UTSW 18 43313501 missense probably benign 0.15
R1337:Stk32a UTSW 18 43261349 missense probably benign 0.00
R1559:Stk32a UTSW 18 43243084 missense probably benign 0.32
R1695:Stk32a UTSW 18 43313420 nonsense probably null
R1874:Stk32a UTSW 18 43261316 missense probably damaging 1.00
R1954:Stk32a UTSW 18 43212025 missense probably benign 0.45
R4980:Stk32a UTSW 18 43314048 missense probably benign 0.01
R5124:Stk32a UTSW 18 43305017 missense probably benign 0.00
R5751:Stk32a UTSW 18 43305020 missense possibly damaging 0.74
R5822:Stk32a UTSW 18 43313487 missense probably benign 0.00
R5863:Stk32a UTSW 18 43315144 missense probably benign 0.00
R6167:Stk32a UTSW 18 43313409 missense probably damaging 1.00
R6355:Stk32a UTSW 18 43297594 splice site probably null
R6731:Stk32a UTSW 18 43305078 missense probably damaging 1.00
R7162:Stk32a UTSW 18 43297584 nonsense probably null
R8001:Stk32a UTSW 18 43315144 missense possibly damaging 0.62
R8022:Stk32a UTSW 18 43315101 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCAGGCAAGCTACTATGG -3'
(R):5'- AACTGTGTCTGCAGATGGATGC -3'

Sequencing Primer
(F):5'- ACAGACATAAAGGTTTTGATGCAC -3'
(R):5'- TGGATGCAGGAGTGTGGAC -3'
Posted On2015-08-18