Incidental Mutation 'R4530:Olfr1085'
ID333065
Institutional Source Beutler Lab
Gene Symbol Olfr1085
Ensembl Gene ENSMUSG00000075176
Gene Nameolfactory receptor 1085
SynonymsGA_x6K02T2Q125-48147264-48146323, MOR191-1
MMRRC Submission 041770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4530 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86653665-86662019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86657561 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 299 (D299G)
Ref Sequence ENSEMBL: ENSMUSP00000150955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099879] [ENSMUST00000213279] [ENSMUST00000214566]
Predicted Effect probably benign
Transcript: ENSMUST00000099879
AA Change: D299G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097464
Gene: ENSMUSG00000075176
AA Change: D299G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.6e-49 PFAM
Pfam:7tm_1 41 290 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213279
AA Change: D299G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000214566
AA Change: D299G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 T C 14: 55,779,028 D322G probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Arhgap42 T C 9: 9,011,432 D451G probably damaging Het
Arhgef7 T C 8: 11,800,802 M144T possibly damaging Het
Arid4b C A 13: 14,126,455 T41N probably damaging Het
Axin1 T A 17: 26,188,172 Y580N probably benign Het
Cdc27 T C 11: 104,528,426 N227D possibly damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Clec2h A G 6: 128,662,494 D18G possibly damaging Het
Clec4e T C 6: 123,289,774 probably benign Het
Cntnap4 T C 8: 112,858,210 I1093T probably benign Het
Dner G T 1: 84,583,015 N136K probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gpr158 A G 2: 21,369,000 S249G probably benign Het
Il16 A C 7: 83,681,310 probably benign Het
Intu T G 3: 40,683,364 C427G possibly damaging Het
Kif21a A C 15: 90,968,089 probably null Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Mroh7 T C 4: 106,720,437 E348G possibly damaging Het
Olfr93 C T 17: 37,151,607 V122M possibly damaging Het
Olfr971 G T 9: 39,840,083 M216I probably benign Het
Olfr981 G A 9: 40,023,293 R300K probably benign Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Prss43 A T 9: 110,829,504 M291L probably benign Het
Rap1gds1 T C 3: 138,957,425 N338D probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Stip1 G T 19: 7,035,658 N19K probably benign Het
Tat T A 8: 109,996,210 F301L probably benign Het
Tmprss11a C A 5: 86,428,681 V104L possibly damaging Het
Ttc3 T A 16: 94,466,877 probably benign Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Vcan A T 13: 89,704,028 F938I probably damaging Het
Wrap73 A G 4: 154,156,707 probably benign Het
Xndc1 C A 7: 102,078,735 N85K probably benign Het
Zfp282 C T 6: 47,890,633 P248S probably benign Het
Zfp930 C T 8: 69,228,831 Q393* probably null Het
Other mutations in Olfr1085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Olfr1085 APN 2 86657726 missense probably damaging 0.98
IGL01137:Olfr1085 APN 2 86657711 missense possibly damaging 0.92
IGL01329:Olfr1085 APN 2 86658207 missense probably benign 0.31
IGL01398:Olfr1085 APN 2 86657688 missense probably damaging 1.00
IGL02248:Olfr1085 APN 2 86657717 missense probably damaging 1.00
IGL02699:Olfr1085 APN 2 86658347 missense probably benign 0.34
IGL02818:Olfr1085 APN 2 86657784 missense probably damaging 1.00
IGL03095:Olfr1085 APN 2 86658431 missense possibly damaging 0.50
IGL03218:Olfr1085 APN 2 86658359 missense probably benign 0.32
R0121:Olfr1085 UTSW 2 86657819 missense probably benign 0.42
R0546:Olfr1085 UTSW 2 86657891 missense possibly damaging 0.91
R0583:Olfr1085 UTSW 2 86658360 missense probably benign 0.20
R0980:Olfr1085 UTSW 2 86657865 missense probably benign 0.39
R2067:Olfr1085 UTSW 2 86658437 missense probably damaging 1.00
R2111:Olfr1085 UTSW 2 86658437 missense probably damaging 1.00
R3760:Olfr1085 UTSW 2 86657888 missense possibly damaging 0.91
R4809:Olfr1085 UTSW 2 86657685 missense possibly damaging 0.95
R5940:Olfr1085 UTSW 2 86658050 missense probably damaging 0.98
R6027:Olfr1085 UTSW 2 86657804 missense probably damaging 1.00
R6417:Olfr1085 UTSW 2 86658166 nonsense probably null
R6420:Olfr1085 UTSW 2 86658166 nonsense probably null
R6619:Olfr1085 UTSW 2 86658062 missense probably damaging 1.00
R6762:Olfr1085 UTSW 2 86657844 missense probably benign 0.22
R6946:Olfr1085 UTSW 2 86657588 missense probably damaging 1.00
R7673:Olfr1085 UTSW 2 86657726 missense probably damaging 1.00
R7718:Olfr1085 UTSW 2 86658029 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GGAAAGCAAGAGCACTTTTCTTTTC -3'
(R):5'- TTCAACCTGTGGGTCTCACC -3'

Sequencing Primer
(F):5'- AGCAAGAGCACTTTTCTTTTCTTCTC -3'
(R):5'- GTGGGTCTCACCTCACTGTG -3'
Posted On2015-08-18