Mutagenetix > Incidental Mutations

Incidental Mutation 'R4530:Intu'

333067

Institutional Source

Beutler Lab

Gene Symbol

Intu

Ensembl Gene

ENSMUSG00000060798

Gene Name

inturned planar cell polarity protein

Synonyms

Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik

MMRRC Submission

041770-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4530 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40531286-40704774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 40683364 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 427 (C427G)

Ref Sequence

ENSEMBL: ENSMUSP00000088725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091186]

AlphaFold

Q059U7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091186
AA Change: C427G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: C427G

Domain	Start	End	E-Value	Type
low complexity region	21	48	N/A	INTRINSIC
low complexity region	64	81	N/A	INTRINSIC
PDZ	187	269	2.09e-3	SMART
low complexity region	459	468	N/A	INTRINSIC
low complexity region	774	784	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000204176
AA Change: C150G

Meta Mutation Damage Score

0.8281

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

93% (37/40)

MGI Phenotype

PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy4	T	C	14: 55,779,028	D322G	probably damaging	Het
Akap9	T	A	5: 4,043,948	F2157I	probably damaging	Het
Arhgap42	T	C	9: 9,011,432	D451G	probably damaging	Het
Arhgef7	T	C	8: 11,800,802	M144T	possibly damaging	Het
Arid4b	C	A	13: 14,126,455	T41N	probably damaging	Het
Axin1	T	A	17: 26,188,172	Y580N	probably benign	Het
Cdc27	T	C	11: 104,528,426	N227D	possibly damaging	Het
Cetn4	C	T	3: 37,309,945	V39I	probably benign	Het
Clec2h	A	G	6: 128,662,494	D18G	possibly damaging	Het
Clec4e	T	C	6: 123,289,774		probably benign	Het
Cntnap4	T	C	8: 112,858,210	I1093T	probably benign	Het
Dner	G	T	1: 84,583,015	N136K	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Gpr158	A	G	2: 21,369,000	S249G	probably benign	Het
Il16	A	C	7: 83,681,310		probably benign	Het
Kif21a	A	C	15: 90,968,089		probably null	Het
Lin54	G	A	5: 100,446,560	T582I	possibly damaging	Het
Mroh7	T	C	4: 106,720,437	E348G	possibly damaging	Het
Olfr1085	T	C	2: 86,657,561	D299G	probably benign	Het
Olfr93	C	T	17: 37,151,607	V122M	possibly damaging	Het
Olfr971	G	T	9: 39,840,083	M216I	probably benign	Het
Olfr981	G	A	9: 40,023,293	R300K	probably benign	Het
Plbd1	T	A	6: 136,651,825	I82F	probably benign	Het
Prss43	A	T	9: 110,829,504	M291L	probably benign	Het
Rap1gds1	T	C	3: 138,957,425	N338D	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,923		probably benign	Het
Stip1	G	T	19: 7,035,658	N19K	probably benign	Het
Tat	T	A	8: 109,996,210	F301L	probably benign	Het
Tmprss11a	C	A	5: 86,428,681	V104L	possibly damaging	Het
Ttc3	T	A	16: 94,466,877		probably benign	Het
Tubgcp3	G	T	8: 12,663,932	L62I	probably damaging	Het
Vcan	A	T	13: 89,704,028	F938I	probably damaging	Het
Wrap73	A	G	4: 154,156,707		probably benign	Het
Xndc1	C	A	7: 102,078,735	N85K	probably benign	Het
Zfp282	C	T	6: 47,890,633	P248S	probably benign	Het
Zfp930	C	T	8: 69,228,831	Q393*	probably null	Het

Other mutations in Intu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01292:Intu	APN	3	40664266	missense	probably benign	0.12
IGL01386:Intu	APN	3	40692587	missense	probably damaging	1.00
IGL02645:Intu	APN	3	40701272	missense	probably benign	0.01
IGL02869:Intu	APN	3	40687786	missense	probably damaging	1.00
IGL03263:Intu	APN	3	40672597	nonsense	probably null
H8562:Intu	UTSW	3	40692673	missense	probably damaging	1.00
PIT4495001:Intu	UTSW	3	40697603	missense	probably benign	0.07
R0010:Intu	UTSW	3	40654272	intron	probably benign
R0173:Intu	UTSW	3	40675346	critical splice donor site	probably null
R0426:Intu	UTSW	3	40675305	missense	probably damaging	0.97
R1566:Intu	UTSW	3	40692578	missense	probably damaging	0.99
R1619:Intu	UTSW	3	40697631	nonsense	probably null
R1658:Intu	UTSW	3	40692781	missense	probably benign	0.20
R1701:Intu	UTSW	3	40664264	missense	probably damaging	1.00
R1707:Intu	UTSW	3	40540924	missense	probably benign	0.03
R1707:Intu	UTSW	3	40683501	missense	possibly damaging	0.69
R1867:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R1868:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R2090:Intu	UTSW	3	40683536	missense	probably benign	0.00
R2310:Intu	UTSW	3	40653813	missense	probably benign
R2989:Intu	UTSW	3	40692710	missense	probably benign	0.11
R4168:Intu	UTSW	3	40672623	missense	probably benign	0.00
R5093:Intu	UTSW	3	40692917	missense	probably benign	0.00
R5541:Intu	UTSW	3	40692587	splice site	probably null
R5587:Intu	UTSW	3	40675308	missense	probably damaging	0.99
R5745:Intu	UTSW	3	40692972	splice site	probably null
R5809:Intu	UTSW	3	40679590	missense	probably damaging	0.99
R5939:Intu	UTSW	3	40692584	missense	probably damaging	1.00
R5953:Intu	UTSW	3	40679550	missense	probably damaging	1.00
R6000:Intu	UTSW	3	40654148	nonsense	probably null
R6063:Intu	UTSW	3	40654094	missense	probably damaging	0.97
R6245:Intu	UTSW	3	40675326	missense	probably damaging	0.98
R6310:Intu	UTSW	3	40701291	nonsense	probably null
R6353:Intu	UTSW	3	40653708	missense	probably damaging	1.00
R6451:Intu	UTSW	3	40701293	missense	possibly damaging	0.94
R6660:Intu	UTSW	3	40531951	missense	probably benign	0.00
R6848:Intu	UTSW	3	40694255	missense	probably benign	0.00
R7440:Intu	UTSW	3	40697551	missense	probably benign	0.04
R7625:Intu	UTSW	3	40697599	missense	probably benign
R7633:Intu	UTSW	3	40654253	missense	probably damaging	1.00
R7798:Intu	UTSW	3	40691929	missense	probably damaging	1.00
R7877:Intu	UTSW	3	40699792	missense	probably benign	0.07
R7978:Intu	UTSW	3	40697639	missense	probably damaging	1.00
R8319:Intu	UTSW	3	40653772	missense	probably damaging	1.00
R8332:Intu	UTSW	3	40675289	missense	probably benign	0.35
R8860:Intu	UTSW	3	40672732	missense	probably benign	0.07
R8926:Intu	UTSW	3	40653709	missense	possibly damaging	0.69
R8946:Intu	UTSW	3	40683359	missense	possibly damaging	0.93
Z1177:Intu	UTSW	3	40697516	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TGTCAGCCCAGCAGTTCTTC -3'
(R):5'- CTCTGATGCTTATTTGGGACCC -3'

Sequencing Primer
(F):5'- AGCAGTTCTTCCCTGGTGTAGC -3'
(R):5'- TGGGACCCCTAAGATTACCTTGAG -3'

Posted On

2015-08-18