Incidental Mutation 'R4530:Intu'
ID333067
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Nameinturned planar cell polarity protein
SynonymsPdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
MMRRC Submission 041770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4530 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location40531286-40704774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 40683364 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 427 (C427G)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091186
AA Change: C427G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: C427G

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204176
AA Change: C150G
Meta Mutation Damage Score 0.8281 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 93% (37/40)
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 T C 14: 55,779,028 D322G probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Arhgap42 T C 9: 9,011,432 D451G probably damaging Het
Arhgef7 T C 8: 11,800,802 M144T possibly damaging Het
Arid4b C A 13: 14,126,455 T41N probably damaging Het
Axin1 T A 17: 26,188,172 Y580N probably benign Het
Cdc27 T C 11: 104,528,426 N227D possibly damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Clec2h A G 6: 128,662,494 D18G possibly damaging Het
Clec4e T C 6: 123,289,774 probably benign Het
Cntnap4 T C 8: 112,858,210 I1093T probably benign Het
Dner G T 1: 84,583,015 N136K probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gpr158 A G 2: 21,369,000 S249G probably benign Het
Il16 A C 7: 83,681,310 probably benign Het
Kif21a A C 15: 90,968,089 probably null Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Mroh7 T C 4: 106,720,437 E348G possibly damaging Het
Olfr1085 T C 2: 86,657,561 D299G probably benign Het
Olfr93 C T 17: 37,151,607 V122M possibly damaging Het
Olfr971 G T 9: 39,840,083 M216I probably benign Het
Olfr981 G A 9: 40,023,293 R300K probably benign Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Prss43 A T 9: 110,829,504 M291L probably benign Het
Rap1gds1 T C 3: 138,957,425 N338D probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Stip1 G T 19: 7,035,658 N19K probably benign Het
Tat T A 8: 109,996,210 F301L probably benign Het
Tmprss11a C A 5: 86,428,681 V104L possibly damaging Het
Ttc3 T A 16: 94,466,877 probably benign Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Vcan A T 13: 89,704,028 F938I probably damaging Het
Wrap73 A G 4: 154,156,707 probably benign Het
Xndc1 C A 7: 102,078,735 N85K probably benign Het
Zfp282 C T 6: 47,890,633 P248S probably benign Het
Zfp930 C T 8: 69,228,831 Q393* probably null Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 unclassified probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGTCAGCCCAGCAGTTCTTC -3'
(R):5'- CTCTGATGCTTATTTGGGACCC -3'

Sequencing Primer
(F):5'- AGCAGTTCTTCCCTGGTGTAGC -3'
(R):5'- TGGGACCCCTAAGATTACCTTGAG -3'
Posted On2015-08-18