Incidental Mutation 'R4530:Intu'
ID 333067
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzk6, 9230116I04Rik, Pdzd6, 9430087H23Rik
MMRRC Submission 041770-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4530 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 40585559-40659206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 40637794 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 427 (C427G)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect possibly damaging
Transcript: ENSMUST00000091186
AA Change: C427G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: C427G

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204176
AA Change: C150G
Meta Mutation Damage Score 0.8281 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 93% (37/40)
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 T C 14: 56,016,485 (GRCm39) D322G probably damaging Het
Akap9 T A 5: 4,093,948 (GRCm39) F2157I probably damaging Het
Arhgap42 T C 9: 9,011,433 (GRCm39) D451G probably damaging Het
Arhgef7 T C 8: 11,850,802 (GRCm39) M144T possibly damaging Het
Arid4b C A 13: 14,301,040 (GRCm39) T41N probably damaging Het
Axin1 T A 17: 26,407,146 (GRCm39) Y580N probably benign Het
Cdc27 T C 11: 104,419,252 (GRCm39) N227D possibly damaging Het
Cetn4 C T 3: 37,364,094 (GRCm39) V39I probably benign Het
Clec2h A G 6: 128,639,457 (GRCm39) D18G possibly damaging Het
Clec4e T C 6: 123,266,733 (GRCm39) probably benign Het
Cntnap4 T C 8: 113,584,842 (GRCm39) I1093T probably benign Het
Dner G T 1: 84,560,736 (GRCm39) N136K probably damaging Het
Gpr158 A G 2: 21,373,811 (GRCm39) S249G probably benign Het
Il16 A C 7: 83,330,518 (GRCm39) probably benign Het
Kif21a A C 15: 90,852,292 (GRCm39) probably null Het
Lin54 G A 5: 100,594,419 (GRCm39) T582I possibly damaging Het
Mroh7 T C 4: 106,577,634 (GRCm39) E348G possibly damaging Het
Or10g6 G A 9: 39,934,589 (GRCm39) R300K probably benign Het
Or2h1b C T 17: 37,462,498 (GRCm39) V122M possibly damaging Het
Or8g2b G T 9: 39,751,379 (GRCm39) M216I probably benign Het
Or8k38 T C 2: 86,487,905 (GRCm39) D299G probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Plbd1 T A 6: 136,628,823 (GRCm39) I82F probably benign Het
Prss43 A T 9: 110,658,572 (GRCm39) M291L probably benign Het
Rap1gds1 T C 3: 138,663,186 (GRCm39) N338D probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,130 (GRCm39) probably benign Het
Stip1 G T 19: 7,013,026 (GRCm39) N19K probably benign Het
Tat T A 8: 110,722,842 (GRCm39) F301L probably benign Het
Tmprss11a C A 5: 86,576,540 (GRCm39) V104L possibly damaging Het
Ttc3 T A 16: 94,267,736 (GRCm39) probably benign Het
Tubgcp3 G T 8: 12,713,932 (GRCm39) L62I probably damaging Het
Vcan A T 13: 89,852,147 (GRCm39) F938I probably damaging Het
Wrap73 A G 4: 154,241,164 (GRCm39) probably benign Het
Xndc1 C A 7: 101,727,942 (GRCm39) N85K probably benign Het
Zfp282 C T 6: 47,867,567 (GRCm39) P248S probably benign Het
Zfp930 C T 8: 69,681,483 (GRCm39) Q393* probably null Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40,618,696 (GRCm39) missense probably benign 0.12
IGL01386:Intu APN 3 40,647,017 (GRCm39) missense probably damaging 1.00
IGL02645:Intu APN 3 40,655,702 (GRCm39) missense probably benign 0.01
IGL02869:Intu APN 3 40,642,216 (GRCm39) missense probably damaging 1.00
IGL03263:Intu APN 3 40,627,027 (GRCm39) nonsense probably null
H8562:Intu UTSW 3 40,647,103 (GRCm39) missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40,652,033 (GRCm39) missense probably benign 0.07
R0010:Intu UTSW 3 40,608,702 (GRCm39) intron probably benign
R0173:Intu UTSW 3 40,629,776 (GRCm39) critical splice donor site probably null
R0426:Intu UTSW 3 40,629,735 (GRCm39) missense probably damaging 0.97
R1566:Intu UTSW 3 40,647,008 (GRCm39) missense probably damaging 0.99
R1619:Intu UTSW 3 40,652,061 (GRCm39) nonsense probably null
R1658:Intu UTSW 3 40,647,211 (GRCm39) missense probably benign 0.20
R1701:Intu UTSW 3 40,618,694 (GRCm39) missense probably damaging 1.00
R1707:Intu UTSW 3 40,637,931 (GRCm39) missense possibly damaging 0.69
R1707:Intu UTSW 3 40,595,073 (GRCm39) missense probably benign 0.03
R1867:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R1868:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R2090:Intu UTSW 3 40,637,966 (GRCm39) missense probably benign 0.00
R2310:Intu UTSW 3 40,608,243 (GRCm39) missense probably benign
R2989:Intu UTSW 3 40,647,140 (GRCm39) missense probably benign 0.11
R4168:Intu UTSW 3 40,627,053 (GRCm39) missense probably benign 0.00
R5093:Intu UTSW 3 40,647,347 (GRCm39) missense probably benign 0.00
R5541:Intu UTSW 3 40,647,017 (GRCm39) splice site probably null
R5587:Intu UTSW 3 40,629,738 (GRCm39) missense probably damaging 0.99
R5745:Intu UTSW 3 40,647,402 (GRCm39) splice site probably null
R5809:Intu UTSW 3 40,634,020 (GRCm39) missense probably damaging 0.99
R5939:Intu UTSW 3 40,647,014 (GRCm39) missense probably damaging 1.00
R5953:Intu UTSW 3 40,633,980 (GRCm39) missense probably damaging 1.00
R6000:Intu UTSW 3 40,608,578 (GRCm39) nonsense probably null
R6063:Intu UTSW 3 40,608,524 (GRCm39) missense probably damaging 0.97
R6245:Intu UTSW 3 40,629,756 (GRCm39) missense probably damaging 0.98
R6310:Intu UTSW 3 40,655,721 (GRCm39) nonsense probably null
R6353:Intu UTSW 3 40,608,138 (GRCm39) missense probably damaging 1.00
R6451:Intu UTSW 3 40,655,723 (GRCm39) missense possibly damaging 0.94
R6660:Intu UTSW 3 40,586,100 (GRCm39) missense probably benign 0.00
R6848:Intu UTSW 3 40,648,685 (GRCm39) missense probably benign 0.00
R7440:Intu UTSW 3 40,651,981 (GRCm39) missense probably benign 0.04
R7625:Intu UTSW 3 40,652,029 (GRCm39) missense probably benign
R7633:Intu UTSW 3 40,608,683 (GRCm39) missense probably damaging 1.00
R7798:Intu UTSW 3 40,646,359 (GRCm39) missense probably damaging 1.00
R7877:Intu UTSW 3 40,654,222 (GRCm39) missense probably benign 0.07
R7978:Intu UTSW 3 40,652,069 (GRCm39) missense probably damaging 1.00
R8319:Intu UTSW 3 40,608,202 (GRCm39) missense probably damaging 1.00
R8332:Intu UTSW 3 40,629,719 (GRCm39) missense probably benign 0.35
R8860:Intu UTSW 3 40,627,162 (GRCm39) missense probably benign 0.07
R8926:Intu UTSW 3 40,608,139 (GRCm39) missense possibly damaging 0.69
R8946:Intu UTSW 3 40,637,789 (GRCm39) missense possibly damaging 0.93
R9164:Intu UTSW 3 40,645,133 (GRCm39) missense probably damaging 1.00
R9191:Intu UTSW 3 40,646,941 (GRCm39) missense probably damaging 0.99
R9547:Intu UTSW 3 40,608,536 (GRCm39) missense probably benign
Z1177:Intu UTSW 3 40,651,946 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGTCAGCCCAGCAGTTCTTC -3'
(R):5'- CTCTGATGCTTATTTGGGACCC -3'

Sequencing Primer
(F):5'- AGCAGTTCTTCCCTGGTGTAGC -3'
(R):5'- TGGGACCCCTAAGATTACCTTGAG -3'
Posted On 2015-08-18