Incidental Mutation 'R4530:Clec4e'
ID333075
Institutional Source Beutler Lab
Gene Symbol Clec4e
Ensembl Gene ENSMUSG00000030142
Gene NameC-type lectin domain family 4, member e
SynonymsClecsf9, Mincle
MMRRC Submission 041770-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4530 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123281789-123289870 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 123289774 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032239] [ENSMUST00000176096] [ENSMUST00000177367]
Predicted Effect probably benign
Transcript: ENSMUST00000032239
SMART Domains Protein: ENSMUSP00000032239
Gene: ENSMUSG00000030142

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
CLECT 80 206 4.82e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175995
Predicted Effect probably benign
Transcript: ENSMUST00000176096
SMART Domains Protein: ENSMUSP00000135682
Gene: ENSMUSG00000030142

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176831
Predicted Effect probably benign
Transcript: ENSMUST00000177367
SMART Domains Protein: ENSMUSP00000135081
Gene: ENSMUSG00000030142

DomainStartEndE-ValueType
CLECT 51 177 4.82e-36 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein is a downstream target of CCAAT/enhancer binding protein (C/EBP), beta (CEBPB) and may play a role in inflammation. Alternative splice variants have been described but their full-length sequence has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation exhibit reduced cytokine (TNF) production after challenge with C. albicans and are more susceptible to systemic candidiasis. The majority of homozygotes also display histological evidence of abnormal heart valves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 T C 14: 55,779,028 D322G probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Arhgap42 T C 9: 9,011,432 D451G probably damaging Het
Arhgef7 T C 8: 11,800,802 M144T possibly damaging Het
Arid4b C A 13: 14,126,455 T41N probably damaging Het
Axin1 T A 17: 26,188,172 Y580N probably benign Het
Cdc27 T C 11: 104,528,426 N227D possibly damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Clec2h A G 6: 128,662,494 D18G possibly damaging Het
Cntnap4 T C 8: 112,858,210 I1093T probably benign Het
Dner G T 1: 84,583,015 N136K probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gpr158 A G 2: 21,369,000 S249G probably benign Het
Il16 A C 7: 83,681,310 probably benign Het
Intu T G 3: 40,683,364 C427G possibly damaging Het
Kif21a A C 15: 90,968,089 probably null Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Mroh7 T C 4: 106,720,437 E348G possibly damaging Het
Olfr1085 T C 2: 86,657,561 D299G probably benign Het
Olfr93 C T 17: 37,151,607 V122M possibly damaging Het
Olfr971 G T 9: 39,840,083 M216I probably benign Het
Olfr981 G A 9: 40,023,293 R300K probably benign Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Prss43 A T 9: 110,829,504 M291L probably benign Het
Rap1gds1 T C 3: 138,957,425 N338D probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Stip1 G T 19: 7,035,658 N19K probably benign Het
Tat T A 8: 109,996,210 F301L probably benign Het
Tmprss11a C A 5: 86,428,681 V104L possibly damaging Het
Ttc3 T A 16: 94,466,877 probably benign Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Vcan A T 13: 89,704,028 F938I probably damaging Het
Wrap73 A G 4: 154,156,707 probably benign Het
Xndc1 C A 7: 102,078,735 N85K probably benign Het
Zfp282 C T 6: 47,890,633 P248S probably benign Het
Zfp930 C T 8: 69,228,831 Q393* probably null Het
Other mutations in Clec4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02713:Clec4e APN 6 123286304 nonsense probably null
IGL03051:Clec4e APN 6 123289733 missense probably benign 0.02
IGL03201:Clec4e APN 6 123283640 missense probably benign 0.03
R0583:Clec4e UTSW 6 123283694 missense probably damaging 1.00
R1467:Clec4e UTSW 6 123285461 splice site probably benign
R1818:Clec4e UTSW 6 123285493 missense possibly damaging 0.87
R1826:Clec4e UTSW 6 123283632 missense probably damaging 1.00
R1968:Clec4e UTSW 6 123283574 missense probably damaging 1.00
R2435:Clec4e UTSW 6 123288896 missense probably damaging 0.99
R6891:Clec4e UTSW 6 123283606 missense probably damaging 1.00
R7531:Clec4e UTSW 6 123285574 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AACAGTCAGCAGGCAAGCTC -3'
(R):5'- CTTGTCCTTGTGCAAGAGAGG -3'

Sequencing Primer
(F):5'- TTCTCCCAGACTCCTCAGCAAG -3'
(R):5'- TCCTTGTGCAAGAGAGGAAATTCTG -3'
Posted On2015-08-18