Incidental Mutation 'R0107:Hps3'
ID33308
Institutional Source Beutler Lab
Gene Symbol Hps3
Ensembl Gene ENSMUSG00000027615
Gene NameHPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonymscoa, cocoa
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0107 (G1)
Quality Score91
Status Validated (trace)
Chromosome3
Chromosomal Location19995945-20035315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20030796 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 76 (L76R)
Ref Sequence ENSEMBL: ENSMUSP00000012580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012580] [ENSMUST00000108321]
Predicted Effect probably damaging
Transcript: ENSMUST00000012580
AA Change: L76R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: L76R

DomainStartEndE-ValueType
Pfam:HPS3_N 3 212 2.8e-74 PFAM
Pfam:HPS3_Mid 255 640 1.3e-167 PFAM
Pfam:HPS3_C 649 1000 1.8e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108321
SMART Domains Protein: ENSMUSP00000103957
Gene: ENSMUSG00000027615

DomainStartEndE-ValueType
Pfam:HPS3_N 3 87 5.6e-25 PFAM
Pfam:HPS3_Mid 121 508 4.2e-161 PFAM
Pfam:HPS3_C 517 870 9.2e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155121
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Hps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Hps3 APN 3 20019807 missense possibly damaging 0.94
IGL00846:Hps3 APN 3 20025792 missense probably benign 0.00
IGL01320:Hps3 APN 3 20030469 missense probably benign 0.12
IGL01364:Hps3 APN 3 20003305 missense possibly damaging 0.58
IGL01751:Hps3 APN 3 20010966 missense probably damaging 1.00
IGL01843:Hps3 APN 3 20029001 missense probably benign 0.05
IGL02294:Hps3 APN 3 20014048 missense probably damaging 1.00
IGL02581:Hps3 APN 3 20003221 intron probably benign
Blue UTSW 3 20030796 missense probably damaging 1.00
earl_grey UTSW 3 20017173 intron probably benign
gandalf UTSW 3 20012796 nonsense probably null
pam_gray UTSW 3 20017173 intron probably benign
R0245:Hps3 UTSW 3 20012796 nonsense probably null
R0421:Hps3 UTSW 3 20029316 missense probably benign 0.00
R0524:Hps3 UTSW 3 20012776 missense probably damaging 1.00
R0763:Hps3 UTSW 3 20003279 missense probably damaging 1.00
R1795:Hps3 UTSW 3 20012695 critical splice donor site probably null
R1864:Hps3 UTSW 3 20019959 critical splice acceptor site probably null
R2029:Hps3 UTSW 3 20030527 missense probably benign 0.01
R2101:Hps3 UTSW 3 20012783 missense possibly damaging 0.95
R2221:Hps3 UTSW 3 20002363 missense probably benign
R2268:Hps3 UTSW 3 20012935 splice site probably benign
R2520:Hps3 UTSW 3 20029030 missense probably damaging 1.00
R3809:Hps3 UTSW 3 20018812 missense probably damaging 1.00
R3888:Hps3 UTSW 3 20003223 critical splice donor site probably null
R3942:Hps3 UTSW 3 19996939 missense probably damaging 1.00
R4022:Hps3 UTSW 3 20035261 missense possibly damaging 0.69
R4156:Hps3 UTSW 3 20029229 missense probably damaging 1.00
R4739:Hps3 UTSW 3 20030410 critical splice acceptor site probably null
R4823:Hps3 UTSW 3 20012726 missense probably benign 0.03
R4912:Hps3 UTSW 3 20014173 missense probably damaging 1.00
R5307:Hps3 UTSW 3 20012701 missense possibly damaging 0.89
R5859:Hps3 UTSW 3 20008870 missense probably benign 0.02
R6140:Hps3 UTSW 3 19996987 missense probably damaging 1.00
R6183:Hps3 UTSW 3 20008868 missense probably benign 0.04
R6971:Hps3 UTSW 3 20011535 missense probably damaging 1.00
R6981:Hps3 UTSW 3 20022820 missense probably damaging 1.00
R7120:Hps3 UTSW 3 20011541 missense probably damaging 1.00
R7146:Hps3 UTSW 3 20008886 missense probably damaging 1.00
R7223:Hps3 UTSW 3 20030419 missense probably benign 0.05
R7448:Hps3 UTSW 3 20035165 missense probably damaging 0.99
R7452:Hps3 UTSW 3 20011428 missense probably damaging 1.00
R7560:Hps3 UTSW 3 20030452 missense probably benign 0.29
R7659:Hps3 UTSW 3 20022814 nonsense probably null
R7769:Hps3 UTSW 3 20018808 splice site probably null
R8050:Hps3 UTSW 3 20003328 missense probably benign
R8242:Hps3 UTSW 3 20014126 missense possibly damaging 0.59
X0021:Hps3 UTSW 3 20030749 missense probably benign 0.14
X0066:Hps3 UTSW 3 20015988 missense probably damaging 1.00
Z1177:Hps3 UTSW 3 20008901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAAATGCATCACGTACCTTCCG -3'
(R):5'- CACACCTCAGAGGCTGTTGCTTAG -3'

Posted On2013-05-09