Incidental Mutation 'R4530:Arid4b'
ID333089
Institutional Source Beutler Lab
Gene Symbol Arid4b
Ensembl Gene ENSMUSG00000039219
Gene NameAT rich interactive domain 4B (RBP1-like)
Synonyms6720480E17Rik, RBBP1L1, Rbp1l1, BRCAA1, SAP180, 6330417L24Rik
MMRRC Submission 041770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4530 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location14063232-14199603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 14126455 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 41 (T41N)
Ref Sequence ENSEMBL: ENSMUSP00000152177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039538] [ENSMUST00000110533] [ENSMUST00000110534] [ENSMUST00000110536] [ENSMUST00000129488] [ENSMUST00000222928]
Predicted Effect probably benign
Transcript: ENSMUST00000039538
AA Change: T41N

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043889
Gene: ENSMUSG00000039219
AA Change: T41N

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 3.4e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
low complexity region 704 713 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 769 785 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
low complexity region 954 964 N/A INTRINSIC
low complexity region 1002 1016 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
coiled coil region 1145 1182 N/A INTRINSIC
low complexity region 1186 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110533
AA Change: T41N

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106162
Gene: ENSMUSG00000039219
AA Change: T41N

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 9.5e-48 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110534
AA Change: T41N

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106163
Gene: ENSMUSG00000039219
AA Change: T41N

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 168 263 4.1e-39 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
TUDOR 567 632 1.91e1 SMART
CHROMO 585 640 1.29e-1 SMART
low complexity region 708 722 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
low complexity region 802 815 N/A INTRINSIC
low complexity region 856 872 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
low complexity region 1041 1051 N/A INTRINSIC
low complexity region 1089 1103 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
coiled coil region 1232 1269 N/A INTRINSIC
low complexity region 1273 1291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110536
AA Change: T41N

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106165
Gene: ENSMUSG00000039219
AA Change: T41N

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 3.4e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
low complexity region 704 713 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 769 785 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
low complexity region 954 964 N/A INTRINSIC
low complexity region 1002 1016 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
coiled coil region 1145 1182 N/A INTRINSIC
low complexity region 1186 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129488
AA Change: T41N

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118687
Gene: ENSMUSG00000039219
AA Change: T41N

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 1.8e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 533 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155553
Predicted Effect probably damaging
Transcript: ENSMUST00000222928
AA Change: T41N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to retinoblastoma-binding protein-1. The encoded protein is a subunit of the histone deacetylase-dependant SIN3A transcriptional corepressor complex, which functions in diverse cellular processes including proliferation, differentiation, apoptosis, oncogenesis, and cell fate determination. The gene product is recognized by IgG antibody isolated from a breast cancer patient and appears to be a molecular marker associated with a broad range of human malignancies. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die pre-implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 T C 14: 55,779,028 D322G probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Arhgap42 T C 9: 9,011,432 D451G probably damaging Het
Arhgef7 T C 8: 11,800,802 M144T possibly damaging Het
Axin1 T A 17: 26,188,172 Y580N probably benign Het
Cdc27 T C 11: 104,528,426 N227D possibly damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Clec2h A G 6: 128,662,494 D18G possibly damaging Het
Clec4e T C 6: 123,289,774 probably benign Het
Cntnap4 T C 8: 112,858,210 I1093T probably benign Het
Dner G T 1: 84,583,015 N136K probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gpr158 A G 2: 21,369,000 S249G probably benign Het
Il16 A C 7: 83,681,310 probably benign Het
Intu T G 3: 40,683,364 C427G possibly damaging Het
Kif21a A C 15: 90,968,089 probably null Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Mroh7 T C 4: 106,720,437 E348G possibly damaging Het
Olfr1085 T C 2: 86,657,561 D299G probably benign Het
Olfr93 C T 17: 37,151,607 V122M possibly damaging Het
Olfr971 G T 9: 39,840,083 M216I probably benign Het
Olfr981 G A 9: 40,023,293 R300K probably benign Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Prss43 A T 9: 110,829,504 M291L probably benign Het
Rap1gds1 T C 3: 138,957,425 N338D probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Stip1 G T 19: 7,035,658 N19K probably benign Het
Tat T A 8: 109,996,210 F301L probably benign Het
Tmprss11a C A 5: 86,428,681 V104L possibly damaging Het
Ttc3 T A 16: 94,466,877 probably benign Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Vcan A T 13: 89,704,028 F938I probably damaging Het
Wrap73 A G 4: 154,156,707 probably benign Het
Xndc1 C A 7: 102,078,735 N85K probably benign Het
Zfp282 C T 6: 47,890,633 P248S probably benign Het
Zfp930 C T 8: 69,228,831 Q393* probably null Het
Other mutations in Arid4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Arid4b APN 13 14191134 unclassified probably benign
IGL00581:Arid4b APN 13 14160195 missense probably damaging 1.00
IGL00808:Arid4b APN 13 14136261 critical splice donor site probably null
IGL01150:Arid4b APN 13 14195374 nonsense probably null
IGL01570:Arid4b APN 13 14186809 unclassified probably benign
IGL01942:Arid4b APN 13 14136164 intron probably benign
IGL02031:Arid4b APN 13 14153412 splice site probably benign
IGL02183:Arid4b APN 13 14169990 missense possibly damaging 0.68
R0096:Arid4b UTSW 13 14129194 missense probably benign 0.08
R0096:Arid4b UTSW 13 14129194 missense probably benign 0.08
R0514:Arid4b UTSW 13 14184317 missense probably damaging 1.00
R0694:Arid4b UTSW 13 14187834 missense probably damaging 0.96
R0746:Arid4b UTSW 13 14143038 missense probably benign 0.01
R1624:Arid4b UTSW 13 14184394 missense probably damaging 0.99
R1625:Arid4b UTSW 13 14187114 missense probably damaging 0.99
R1812:Arid4b UTSW 13 14195429 missense probably damaging 1.00
R1891:Arid4b UTSW 13 14136236 missense possibly damaging 0.94
R1990:Arid4b UTSW 13 14132436 missense probably damaging 0.99
R2051:Arid4b UTSW 13 14187645 missense probably damaging 0.98
R2060:Arid4b UTSW 13 14195452 missense probably damaging 1.00
R2344:Arid4b UTSW 13 14153490 missense probably benign 0.26
R3605:Arid4b UTSW 13 14120241 missense probably damaging 1.00
R3606:Arid4b UTSW 13 14120241 missense probably damaging 1.00
R3844:Arid4b UTSW 13 14187060 missense probably damaging 0.99
R3909:Arid4b UTSW 13 14132484 missense probably damaging 1.00
R3938:Arid4b UTSW 13 14186928 missense probably benign 0.34
R4394:Arid4b UTSW 13 14154972 splice site probably null
R4466:Arid4b UTSW 13 14132510 missense probably damaging 1.00
R4537:Arid4b UTSW 13 14120161 nonsense probably null
R4829:Arid4b UTSW 13 14184438 missense probably benign 0.23
R4930:Arid4b UTSW 13 14187477 missense probably damaging 0.99
R4972:Arid4b UTSW 13 14160272 missense probably benign 0.07
R5119:Arid4b UTSW 13 14164281 missense probably benign 0.15
R5236:Arid4b UTSW 13 14126449 critical splice acceptor site probably null
R5304:Arid4b UTSW 13 14186929 missense probably benign 0.34
R5439:Arid4b UTSW 13 14187696 missense probably damaging 0.99
R5734:Arid4b UTSW 13 14160271 missense probably benign 0.09
R5950:Arid4b UTSW 13 14191264 splice site probably benign
R5951:Arid4b UTSW 13 14143063 missense possibly damaging 0.80
R6645:Arid4b UTSW 13 14120152 missense probably damaging 1.00
R6765:Arid4b UTSW 13 14187315 missense possibly damaging 0.84
R6804:Arid4b UTSW 13 14129207 missense probably benign 0.44
R7342:Arid4b UTSW 13 14136219 missense probably benign 0.03
R7354:Arid4b UTSW 13 14164870 missense probably benign 0.19
R7426:Arid4b UTSW 13 14181306 critical splice donor site probably null
R7863:Arid4b UTSW 13 14164149 missense probably benign 0.01
R7946:Arid4b UTSW 13 14164149 missense probably benign 0.01
R8070:Arid4b UTSW 13 14136259 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GAATATCCAGCCTTGTAGTTGTAGTG -3'
(R):5'- ACAGTCAACCTCCTTAATGCTC -3'

Sequencing Primer
(F):5'- CCAGCCTTGTAGTTGTAGTGTCTAG -3'
(R):5'- ACACAGATTTTGCTATCACTTCAG -3'
Posted On2015-08-18