Incidental Mutation 'R0107:Spag17'
ID33312
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission 038393-MU
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0107 (G1)
Quality Score100
Status Validated (trace)
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100050787 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 920 (K920N)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164539
AA Change: K920N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: K920N

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
PIT4504001:Spag17 UTSW 3 100103110 critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 100013211 missense possibly damaging 0.53
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99984609 missense probably benign 0.00
R7084:Spag17 UTSW 3 99939270 missense probably benign 0.18
R7126:Spag17 UTSW 3 100101435 missense probably benign 0.00
R7144:Spag17 UTSW 3 100027401 splice site probably null
R7198:Spag17 UTSW 3 100095572 missense probably benign 0.02
R7318:Spag17 UTSW 3 99939983 missense probably benign 0.00
R7403:Spag17 UTSW 3 99939375 missense possibly damaging 0.53
R7409:Spag17 UTSW 3 100027231 missense possibly damaging 0.73
R7409:Spag17 UTSW 3 100034159 missense probably benign 0.00
R7537:Spag17 UTSW 3 99939247 missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100095595 nonsense probably null
R7772:Spag17 UTSW 3 100080118 missense probably damaging 0.98
R7842:Spag17 UTSW 3 100053858 missense probably benign 0.18
R7963:Spag17 UTSW 3 100022638 missense probably benign 0.02
R8168:Spag17 UTSW 3 100034984 missense possibly damaging 0.96
R8291:Spag17 UTSW 3 100060850 missense probably benign
R8347:Spag17 UTSW 3 100027641 missense probably benign
R8383:Spag17 UTSW 3 100085392 missense probably damaging 0.98
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Z1176:Spag17 UTSW 3 100012993 missense probably benign 0.18
Z1177:Spag17 UTSW 3 100088399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATGCCATCACCAAAGGCTC -3'
(R):5'- CATGTGGCAAAGCTGTGAAGACAC -3'

Sequencing Primer
(F):5'- GGCTCAGCACTACTCAGGTATAG -3'
(R):5'- GACACAAGGTTTTTCACTGAGGC -3'
Posted On2013-05-09