Incidental Mutation 'R4532:Zfp655'
ID333141
Institutional Source Beutler Lab
Gene Symbol Zfp655
Ensembl Gene ENSMUSG00000007812
Gene Namezinc finger protein 655
Synonyms9030409O18Rik, 2700038I16Rik
MMRRC Submission 041772-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R4532 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location145231715-145247302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145244697 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 455 (I455N)
Ref Sequence ENSEMBL: ENSMUSP00000128969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167316] [ENSMUST00000199322]
Predicted Effect probably benign
Transcript: ENSMUST00000167316
AA Change: I455N

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128969
Gene: ENSMUSG00000007812
AA Change: I455N

DomainStartEndE-ValueType
ZnF_C2H2 243 265 5.29e-5 SMART
ZnF_C2H2 271 293 2.99e-4 SMART
ZnF_C2H2 299 328 1.38e2 SMART
ZnF_C2H2 334 356 6.78e-3 SMART
ZnF_C2H2 361 383 3.99e0 SMART
ZnF_C2H2 411 433 3.63e-3 SMART
ZnF_C2H2 439 461 1.01e-1 SMART
low complexity region 463 475 N/A INTRINSIC
ZnF_C2H2 495 517 6.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199322
Meta Mutation Damage Score 0.1799 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein. The zinc finger proteins are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Ap3b1 A G 13: 94,565,735 K1099E unknown Het
Arhgap42 T C 9: 9,011,432 D451G probably damaging Het
Cd19 C T 7: 126,412,109 C301Y probably damaging Het
Cdh23 T C 10: 60,534,423 T198A probably benign Het
Cdt1 T C 8: 122,571,756 S407P probably benign Het
Cyp26c1 A G 19: 37,685,779 T34A probably damaging Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Doxl2 A G 6: 48,978,167 E647G possibly damaging Het
Eif5 T A 12: 111,539,884 C52* probably null Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fhod3 A G 18: 25,110,221 Y1212C probably damaging Het
Ggh T A 4: 20,046,225 F44L probably benign Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm21095 A G Y: 84,120,684 N149S probably damaging Het
Gys2 T A 6: 142,455,141 H311L probably damaging Het
Hcn4 C T 9: 58,857,798 R558C unknown Het
Heatr6 T C 11: 83,769,672 L546P probably damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Lpin1 C T 12: 16,553,962 G623S probably benign Het
Lrfn2 A G 17: 49,070,536 D215G probably damaging Het
Lrrc3c C A 11: 98,599,033 S72* probably null Het
Me3 G A 7: 89,632,900 probably benign Het
Msln A G 17: 25,750,724 I344T probably damaging Het
Olfr1040 A T 2: 86,145,930 L268Q possibly damaging Het
Olfr481 T C 7: 108,081,549 Y252H probably benign Het
Oma1 G A 4: 103,319,374 V112I probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pdgfra A G 5: 75,181,083 N659S probably damaging Het
Rmnd5a A T 6: 71,399,125 probably null Het
Slc12a8 C A 16: 33,551,033 R180S probably damaging Het
Slc6a15 G A 10: 103,409,787 V544M possibly damaging Het
Slco5a1 T A 1: 12,879,223 T648S probably damaging Het
Snx13 T C 12: 35,144,220 F921L probably damaging Het
Stard6 A C 18: 70,483,534 D88A probably damaging Het
Svep1 G T 4: 58,068,886 H2967N possibly damaging Het
Tcaf2 A C 6: 42,626,437 Y730D probably damaging Het
Tes G A 6: 17,097,408 V172M possibly damaging Het
Ttc3 T A 16: 94,466,877 probably benign Het
Vmn1r23 A G 6: 57,925,929 I288T probably benign Het
Vmn1r38 G T 6: 66,777,032 H33Q probably benign Het
Vmn2r75 G T 7: 86,148,141 C821* probably null Het
Zfp282 C T 6: 47,890,633 P248S probably benign Het
Other mutations in Zfp655
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Zfp655 APN 5 145244145 missense probably damaging 1.00
IGL01679:Zfp655 APN 5 145243827 missense probably damaging 0.96
IGL02379:Zfp655 APN 5 145243955 missense probably benign 0.13
IGL02647:Zfp655 APN 5 145243006 missense probably benign
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0270:Zfp655 UTSW 5 145244457 missense probably damaging 1.00
R0608:Zfp655 UTSW 5 145244057 missense possibly damaging 0.57
R1528:Zfp655 UTSW 5 145244601 missense probably damaging 0.98
R2076:Zfp655 UTSW 5 145244600 missense possibly damaging 0.89
R2119:Zfp655 UTSW 5 145244784 missense probably damaging 0.98
R2375:Zfp655 UTSW 5 145244396 missense probably benign 0.10
R2403:Zfp655 UTSW 5 145244546 missense probably benign 0.00
R4032:Zfp655 UTSW 5 145244048 missense possibly damaging 0.50
R4880:Zfp655 UTSW 5 145244358 missense probably damaging 0.99
R5484:Zfp655 UTSW 5 145243635 missense probably benign 0.01
R5529:Zfp655 UTSW 5 145244736 missense probably damaging 0.96
R6193:Zfp655 UTSW 5 145244776 missense probably benign 0.03
R6195:Zfp655 UTSW 5 145243762 missense possibly damaging 0.52
R7050:Zfp655 UTSW 5 145244735 missense probably benign 0.12
R7471:Zfp655 UTSW 5 145244732 missense possibly damaging 0.80
R7612:Zfp655 UTSW 5 145237189 missense unknown
R7626:Zfp655 UTSW 5 145237107 missense probably damaging 1.00
R7989:Zfp655 UTSW 5 145244570 missense probably damaging 1.00
R8557:Zfp655 UTSW 5 145244025 missense probably benign 0.37
R8805:Zfp655 UTSW 5 145244480 missense probably damaging 1.00
Z1176:Zfp655 UTSW 5 145244003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGAATGTGGGCTGGCC -3'
(R):5'- GAACTTGACTAAATGTCTCCCCAAG -3'

Sequencing Primer
(F):5'- TGGGCTGGCCTATGTTAAACAAC -3'
(R):5'- CCAAGTTCACTGCATTCATAAGG -3'
Posted On2015-08-18