Incidental Mutation 'R4532:Vmn1r38'
ID333147
Institutional Source Beutler Lab
Gene Symbol Vmn1r38
Ensembl Gene ENSMUSG00000115170
Gene Namevomeronasal 1 receptor 38
SynonymsV1rc13
MMRRC Submission 041772-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R4532 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location66774003-66782627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66777032 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 33 (H33Q)
Ref Sequence ENSEMBL: ENSMUSP00000154495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176121] [ENSMUST00000226457] [ENSMUST00000227493] [ENSMUST00000227694]
Predicted Effect probably benign
Transcript: ENSMUST00000176121
AA Change: H33Q

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135117
Gene: ENSMUSG00000093632
AA Change: H33Q

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226457
AA Change: H33Q

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000227493
AA Change: H33Q

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000227694
AA Change: H33Q

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Ap3b1 A G 13: 94,565,735 K1099E unknown Het
Arhgap42 T C 9: 9,011,432 D451G probably damaging Het
Cd19 C T 7: 126,412,109 C301Y probably damaging Het
Cdh23 T C 10: 60,534,423 T198A probably benign Het
Cdt1 T C 8: 122,571,756 S407P probably benign Het
Cyp26c1 A G 19: 37,685,779 T34A probably damaging Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Doxl2 A G 6: 48,978,167 E647G possibly damaging Het
Eif5 T A 12: 111,539,884 C52* probably null Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fhod3 A G 18: 25,110,221 Y1212C probably damaging Het
Ggh T A 4: 20,046,225 F44L probably benign Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm21095 A G Y: 84,120,684 N149S probably damaging Het
Gys2 T A 6: 142,455,141 H311L probably damaging Het
Hcn4 C T 9: 58,857,798 R558C unknown Het
Heatr6 T C 11: 83,769,672 L546P probably damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Lpin1 C T 12: 16,553,962 G623S probably benign Het
Lrfn2 A G 17: 49,070,536 D215G probably damaging Het
Lrrc3c C A 11: 98,599,033 S72* probably null Het
Me3 G A 7: 89,632,900 probably benign Het
Msln A G 17: 25,750,724 I344T probably damaging Het
Olfr1040 A T 2: 86,145,930 L268Q possibly damaging Het
Olfr481 T C 7: 108,081,549 Y252H probably benign Het
Oma1 G A 4: 103,319,374 V112I probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pdgfra A G 5: 75,181,083 N659S probably damaging Het
Rmnd5a A T 6: 71,399,125 probably null Het
Slc12a8 C A 16: 33,551,033 R180S probably damaging Het
Slc6a15 G A 10: 103,409,787 V544M possibly damaging Het
Slco5a1 T A 1: 12,879,223 T648S probably damaging Het
Snx13 T C 12: 35,144,220 F921L probably damaging Het
Stard6 A C 18: 70,483,534 D88A probably damaging Het
Svep1 G T 4: 58,068,886 H2967N possibly damaging Het
Tcaf2 A C 6: 42,626,437 Y730D probably damaging Het
Tes G A 6: 17,097,408 V172M possibly damaging Het
Ttc3 T A 16: 94,466,877 probably benign Het
Vmn1r23 A G 6: 57,925,929 I288T probably benign Het
Vmn2r75 G T 7: 86,148,141 C821* probably null Het
Zfp282 C T 6: 47,890,633 P248S probably benign Het
Zfp655 T A 5: 145,244,697 I455N probably benign Het
Other mutations in Vmn1r38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Vmn1r38 APN 6 66776376 missense probably benign 0.00
IGL02471:Vmn1r38 APN 6 66776767 missense probably benign 0.06
R0483:Vmn1r38 UTSW 6 66776995 missense probably benign 0.10
R0890:Vmn1r38 UTSW 6 66776530 missense probably benign 0.01
R1242:Vmn1r38 UTSW 6 66776360 nonsense probably null
R1557:Vmn1r38 UTSW 6 66776386 missense probably benign 0.01
R2266:Vmn1r38 UTSW 6 66776449 missense probably benign 0.02
R2320:Vmn1r38 UTSW 6 66776550 missense possibly damaging 0.94
R2568:Vmn1r38 UTSW 6 66776971 missense probably benign 0.00
R3104:Vmn1r38 UTSW 6 66776446 missense probably benign 0.31
R3552:Vmn1r38 UTSW 6 66776493 missense possibly damaging 0.95
R3792:Vmn1r38 UTSW 6 66776907 missense probably benign 0.01
R4061:Vmn1r38 UTSW 6 66776848 missense possibly damaging 0.87
R5299:Vmn1r38 UTSW 6 66776698 missense probably benign 0.06
R7173:Vmn1r38 UTSW 6 66776294 missense possibly damaging 0.88
R8044:Vmn1r38 UTSW 6 66776532 missense not run
X0022:Vmn1r38 UTSW 6 66777067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGACCTCTCATTGCCCTG -3'
(R):5'- AGGTGTAATACGGGCACAC -3'

Sequencing Primer
(F):5'- GCCCTGTTTAAGTAAGAAGTTGCC -3'
(R):5'- TCTATATAGATGTGACTGGGAATGC -3'
Posted On2015-08-18