Mutagenetix > Incidental Mutation

Incidental Mutation 'R4532:Slc6a15'

333157

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

041772-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4532 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 103409787 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 544 (V544M)

Ref Sequence

ENSEMBL: ENSMUSP00000136676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]

AlphaFold

Q8BG16

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074204
AA Change: V544M

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: V544M

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179636
AA Change: V544M

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: V544M

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	T	A	5: 4,043,948	F2157I	probably damaging	Het
Ap3b1	A	G	13: 94,565,735	K1099E	unknown	Het
Arhgap42	T	C	9: 9,011,432	D451G	probably damaging	Het
Cd19	C	T	7: 126,412,109	C301Y	probably damaging	Het
Cdh23	T	C	10: 60,534,423	T198A	probably benign	Het
Cdt1	T	C	8: 122,571,756	S407P	probably benign	Het
Cyp26c1	A	G	19: 37,685,779	T34A	probably damaging	Het
Dbh	C	A	2: 27,177,331	H409Q	possibly damaging	Het
Doxl2	A	G	6: 48,978,167	E647G	possibly damaging	Het
Eif5	T	A	12: 111,539,884	C52*	probably null	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fhod3	A	G	18: 25,110,221	Y1212C	probably damaging	Het
Ggh	T	A	4: 20,046,225	F44L	probably benign	Het
Gm12185	T	C	11: 48,907,920	Y582C	probably damaging	Het
Gm12185	T	C	11: 48,908,094	N524S	possibly damaging	Het
Gm21095	A	G	Y: 84,120,684	N149S	probably damaging	Het
Gys2	T	A	6: 142,455,141	H311L	probably damaging	Het
Hcn4	C	T	9: 58,857,798	R558C	unknown	Het
Heatr6	T	C	11: 83,769,672	L546P	probably damaging	Het
Lin54	G	A	5: 100,446,560	T582I	possibly damaging	Het
Lpin1	C	T	12: 16,553,962	G623S	probably benign	Het
Lrfn2	A	G	17: 49,070,536	D215G	probably damaging	Het
Lrrc3c	C	A	11: 98,599,033	S72*	probably null	Het
Me3	G	A	7: 89,632,900		probably benign	Het
Msln	A	G	17: 25,750,724	I344T	probably damaging	Het
Olfr1040	A	T	2: 86,145,930	L268Q	possibly damaging	Het
Olfr481	T	C	7: 108,081,549	Y252H	probably benign	Het
Oma1	G	A	4: 103,319,374	V112I	probably benign	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pdgfra	A	G	5: 75,181,083	N659S	probably damaging	Het
Rmnd5a	A	T	6: 71,399,125		probably null	Het
Slc12a8	C	A	16: 33,551,033	R180S	probably damaging	Het
Slco5a1	T	A	1: 12,879,223	T648S	probably damaging	Het
Snx13	T	C	12: 35,144,220	F921L	probably damaging	Het
Stard6	A	C	18: 70,483,534	D88A	probably damaging	Het
Svep1	G	T	4: 58,068,886	H2967N	possibly damaging	Het
Tcaf2	A	C	6: 42,626,437	Y730D	probably damaging	Het
Tes	G	A	6: 17,097,408	V172M	possibly damaging	Het
Ttc3	T	A	16: 94,466,877		probably benign	Het
Vmn1r23	A	G	6: 57,925,929	I288T	probably benign	Het
Vmn1r38	G	T	6: 66,777,032	H33Q	probably benign	Het
Vmn2r75	G	T	7: 86,148,141	C821*	probably null	Het
Zfp282	C	T	6: 47,890,633	P248S	probably benign	Het
Zfp655	T	A	5: 145,244,697	I455N	probably benign	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R8978:Slc6a15	UTSW	10	103395092	nonsense	probably null
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9493:Slc6a15	UTSW	10	103393416	missense	probably benign	0.35
R9529:Slc6a15	UTSW	10	103404722	missense	probably benign	0.14
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGTGACTCAACTCCCAACATG -3'
(R):5'- GCGTACACCTCAGTAAATTCCC -3'

Sequencing Primer
(F):5'- TTTCCATAGAGTCAGAGAAGCTAGTG -3'
(R):5'- TTCCCCTATCAACAAAAGCCTGTG -3'

Posted On

2015-08-18