Incidental Mutation 'R4532:Slc6a15'
ID 333157
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission 041772-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4532 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 103203644-103255238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103245648 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 544 (V544M)
Ref Sequence ENSEMBL: ENSMUSP00000136676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect possibly damaging
Transcript: ENSMUST00000074204
AA Change: V544M

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: V544M

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179636
AA Change: V544M

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: V544M

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,093,948 (GRCm39) F2157I probably damaging Het
Aoc1l1 A G 6: 48,955,101 (GRCm39) E647G possibly damaging Het
Ap3b1 A G 13: 94,702,243 (GRCm39) K1099E unknown Het
Arhgap42 T C 9: 9,011,433 (GRCm39) D451G probably damaging Het
Cd19 C T 7: 126,011,281 (GRCm39) C301Y probably damaging Het
Cdh23 T C 10: 60,370,202 (GRCm39) T198A probably benign Het
Cdt1 T C 8: 123,298,495 (GRCm39) S407P probably benign Het
Cyp26c1 A G 19: 37,674,227 (GRCm39) T34A probably damaging Het
Dbh C A 2: 27,067,343 (GRCm39) H409Q possibly damaging Het
Eif5 T A 12: 111,506,318 (GRCm39) C52* probably null Het
Fhod3 A G 18: 25,243,278 (GRCm39) Y1212C probably damaging Het
Ggh T A 4: 20,046,225 (GRCm39) F44L probably benign Het
Gm12185 T C 11: 48,798,747 (GRCm39) Y582C probably damaging Het
Gm12185 T C 11: 48,798,921 (GRCm39) N524S possibly damaging Het
Gm21095 A G Y: 84,131,953 (GRCm39) N149S probably damaging Het
Gys2 T A 6: 142,400,867 (GRCm39) H311L probably damaging Het
Hcn4 C T 9: 58,765,081 (GRCm39) R558C unknown Het
Heatr6 T C 11: 83,660,498 (GRCm39) L546P probably damaging Het
Lin54 G A 5: 100,594,419 (GRCm39) T582I possibly damaging Het
Lpin1 C T 12: 16,603,963 (GRCm39) G623S probably benign Het
Lrfn2 A G 17: 49,377,564 (GRCm39) D215G probably damaging Het
Lrrc3c C A 11: 98,489,859 (GRCm39) S72* probably null Het
Me3 G A 7: 89,282,108 (GRCm39) probably benign Het
Msln A G 17: 25,969,698 (GRCm39) I344T probably damaging Het
Oma1 G A 4: 103,176,571 (GRCm39) V112I probably benign Het
Or5al6 A T 2: 85,976,274 (GRCm39) L268Q possibly damaging Het
Or5p4 T C 7: 107,680,756 (GRCm39) Y252H probably benign Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Pdgfra A G 5: 75,341,744 (GRCm39) N659S probably damaging Het
Rmnd5a A T 6: 71,376,109 (GRCm39) probably null Het
Slc12a8 C A 16: 33,371,403 (GRCm39) R180S probably damaging Het
Slco5a1 T A 1: 12,949,447 (GRCm39) T648S probably damaging Het
Snx13 T C 12: 35,194,219 (GRCm39) F921L probably damaging Het
Stard6 A C 18: 70,616,605 (GRCm39) D88A probably damaging Het
Svep1 G T 4: 58,068,886 (GRCm39) H2967N possibly damaging Het
Tcaf2 A C 6: 42,603,371 (GRCm39) Y730D probably damaging Het
Tes G A 6: 17,097,407 (GRCm39) V172M possibly damaging Het
Ttc3 T A 16: 94,267,736 (GRCm39) probably benign Het
Vmn1r23 A G 6: 57,902,914 (GRCm39) I288T probably benign Het
Vmn1r38 G T 6: 66,754,016 (GRCm39) H33Q probably benign Het
Vmn2r75 G T 7: 85,797,349 (GRCm39) C821* probably null Het
Zfp282 C T 6: 47,867,567 (GRCm39) P248S probably benign Het
Zfp655 T A 5: 145,181,507 (GRCm39) I455N probably benign Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103,225,002 (GRCm39) missense probably benign
IGL01320:Slc6a15 APN 10 103,240,606 (GRCm39) missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103,240,686 (GRCm39) splice site probably null
IGL02066:Slc6a15 APN 10 103,252,519 (GRCm39) missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103,254,083 (GRCm39) missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103,240,136 (GRCm39) splice site probably benign
IGL02744:Slc6a15 APN 10 103,253,894 (GRCm39) missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103,252,541 (GRCm39) missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103,253,929 (GRCm39) missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103,225,208 (GRCm39) splice site probably benign
R0165:Slc6a15 UTSW 10 103,245,670 (GRCm39) missense probably null 0.04
R0349:Slc6a15 UTSW 10 103,254,086 (GRCm39) missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103,253,914 (GRCm39) missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103,240,213 (GRCm39) nonsense probably null
R0784:Slc6a15 UTSW 10 103,252,661 (GRCm39) splice site probably benign
R0944:Slc6a15 UTSW 10 103,245,657 (GRCm39) missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103,236,121 (GRCm39) missense probably benign
R1882:Slc6a15 UTSW 10 103,230,925 (GRCm39) missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103,245,595 (GRCm39) missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103,229,269 (GRCm39) missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103,252,646 (GRCm39) missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103,240,552 (GRCm39) missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103,254,248 (GRCm39) missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103,229,275 (GRCm39) missense probably benign 0.00
R4825:Slc6a15 UTSW 10 103,253,921 (GRCm39) missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103,240,275 (GRCm39) missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103,225,087 (GRCm39) missense probably benign
R5320:Slc6a15 UTSW 10 103,244,067 (GRCm39) missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103,229,369 (GRCm39) missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103,225,031 (GRCm39) missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103,240,228 (GRCm39) missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103,229,775 (GRCm39) missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103,230,928 (GRCm39) missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103,244,163 (GRCm39) missense probably benign
R7549:Slc6a15 UTSW 10 103,224,998 (GRCm39) missense probably benign
R7660:Slc6a15 UTSW 10 103,229,241 (GRCm39) splice site probably null
R7839:Slc6a15 UTSW 10 103,240,660 (GRCm39) missense probably benign
R7948:Slc6a15 UTSW 10 103,240,156 (GRCm39) missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103,229,890 (GRCm39) critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103,225,048 (GRCm39) missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103,245,556 (GRCm39) missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103,225,112 (GRCm39) missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103,240,176 (GRCm39) missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103,225,179 (GRCm39) missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103,229,357 (GRCm39) missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103,230,953 (GRCm39) nonsense probably null
R9050:Slc6a15 UTSW 10 103,252,516 (GRCm39) missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103,236,140 (GRCm39) missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103,229,406 (GRCm39) nonsense probably null
R9493:Slc6a15 UTSW 10 103,229,277 (GRCm39) missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103,240,583 (GRCm39) missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103,240,333 (GRCm39) missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103,236,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGACTCAACTCCCAACATG -3'
(R):5'- GCGTACACCTCAGTAAATTCCC -3'

Sequencing Primer
(F):5'- TTTCCATAGAGTCAGAGAAGCTAGTG -3'
(R):5'- TTCCCCTATCAACAAAAGCCTGTG -3'
Posted On 2015-08-18