Incidental Mutation 'R0107:Ankle2'
ID33316
Institutional Source Beutler Lab
Gene Symbol Ankle2
Ensembl Gene ENSMUSG00000029501
Gene Nameankyrin repeat and LEM domain containing 2
Synonyms1110001J12Rik, D5Ertd585e
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R0107 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location110231004-110256651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110253027 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 743 (V743A)
Ref Sequence ENSEMBL: ENSMUSP00000143044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031474] [ENSMUST00000086674] [ENSMUST00000197188]
Predicted Effect probably benign
Transcript: ENSMUST00000031474
AA Change: V742A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031474
Gene: ENSMUSG00000029501
AA Change: V742A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 74 112 6.6e-12 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 923 937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086674
SMART Domains Protein: ENSMUSP00000083878
Gene: ENSMUSG00000029501

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 75 114 5.8e-9 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 845 859 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196821
Predicted Effect probably benign
Transcript: ENSMUST00000197188
AA Change: V743A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143044
Gene: ENSMUSG00000029501
AA Change: V743A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 75 114 6.4e-9 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 923 937 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LEM family of inner nuclear membrane proteins. The encoded protein functions as a mitotic regulator through postmitotic formation of the nuclear envelope. Mutations in this gene cause morphology defects in the nuclear envelope and BAF hyperphosphorylation. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Ankle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Ankle2 APN 5 110234352 missense probably benign 0.01
IGL03030:Ankle2 APN 5 110251610 missense possibly damaging 0.93
R0219:Ankle2 UTSW 5 110251645 nonsense probably null
R0288:Ankle2 UTSW 5 110236390 missense probably damaging 0.96
R0511:Ankle2 UTSW 5 110242059 splice site probably benign
R1343:Ankle2 UTSW 5 110237966 missense probably damaging 1.00
R2079:Ankle2 UTSW 5 110244505 missense probably damaging 1.00
R3954:Ankle2 UTSW 5 110251675 missense probably benign 0.00
R4161:Ankle2 UTSW 5 110234368 missense probably benign 0.06
R4196:Ankle2 UTSW 5 110244543 missense possibly damaging 0.81
R4613:Ankle2 UTSW 5 110231379 missense probably benign
R4830:Ankle2 UTSW 5 110242013 missense probably damaging 1.00
R4870:Ankle2 UTSW 5 110251478 splice site probably null
R4946:Ankle2 UTSW 5 110253838 missense probably benign 0.06
R5537:Ankle2 UTSW 5 110249495 missense probably damaging 1.00
R5798:Ankle2 UTSW 5 110251535 missense probably damaging 1.00
R5809:Ankle2 UTSW 5 110237990 missense probably damaging 0.99
R6434:Ankle2 UTSW 5 110253893 missense probably damaging 1.00
R6825:Ankle2 UTSW 5 110250769 missense probably null 0.78
R7264:Ankle2 UTSW 5 110237823 missense probably damaging 1.00
R7296:Ankle2 UTSW 5 110237724 missense probably damaging 1.00
R7318:Ankle2 UTSW 5 110237766 missense probably benign 0.19
R7429:Ankle2 UTSW 5 110234518 missense possibly damaging 0.86
R8035:Ankle2 UTSW 5 110254452 missense probably damaging 1.00
R8079:Ankle2 UTSW 5 110231316 missense probably damaging 1.00
R8257:Ankle2 UTSW 5 110253915 critical splice donor site probably null
R8348:Ankle2 UTSW 5 110242043 missense possibly damaging 0.68
R8448:Ankle2 UTSW 5 110242043 missense possibly damaging 0.68
R8478:Ankle2 UTSW 5 110252952 missense possibly damaging 0.92
X0026:Ankle2 UTSW 5 110253120 missense probably benign 0.01
X0065:Ankle2 UTSW 5 110236357 missense probably damaging 0.99
Z1176:Ankle2 UTSW 5 110234499 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGTTCCAAGTCAGAGTCAGCCCAC -3'
(R):5'- GCCCAAAGACATTTCAGCCATTGC -3'

Sequencing Primer
(F):5'- GTTCCAAACCTCTAAAAGTGGTTCC -3'
(R):5'- AGCCATTGCCTCTGACAC -3'
Posted On2013-05-09