Incidental Mutation 'R4532:Slc12a8'
ID333166
Institutional Source Beutler Lab
Gene Symbol Slc12a8
Ensembl Gene ENSMUSG00000035506
Gene Namesolute carrier family 12 (potassium/chloride transporters), member 8
Synonyms
MMRRC Submission 041772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4532 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33517328-33664135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33551033 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 180 (R180S)
Ref Sequence ENSEMBL: ENSMUSP00000112439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059056] [ENSMUST00000119173] [ENSMUST00000121925] [ENSMUST00000122427]
Predicted Effect probably damaging
Transcript: ENSMUST00000059056
AA Change: R180S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062337
Gene: ENSMUSG00000035506
AA Change: R180S

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 410 4e-24 PFAM
Pfam:AA_permease 43 409 5.3e-51 PFAM
low complexity region 481 496 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119173
AA Change: R149S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113633
Gene: ENSMUSG00000035506
AA Change: R149S

DomainStartEndE-ValueType
Pfam:AA_permease_2 7 266 4.2e-15 PFAM
Pfam:AA_permease 12 267 1.9e-37 PFAM
transmembrane domain 295 317 N/A INTRINSIC
low complexity region 401 416 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 532 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121925
AA Change: R180S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112439
Gene: ENSMUSG00000035506
AA Change: R180S

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 409 2.4e-23 PFAM
Pfam:AA_permease 43 409 5e-50 PFAM
low complexity region 481 496 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122427
AA Change: R180S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113164
Gene: ENSMUSG00000035506
AA Change: R180S

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 386 7.7e-18 PFAM
Pfam:AA_permease 43 381 1.3e-44 PFAM
low complexity region 455 470 N/A INTRINSIC
Meta Mutation Damage Score 0.1638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be a candidate for psoriasis susceptibility. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Ap3b1 A G 13: 94,565,735 K1099E unknown Het
Arhgap42 T C 9: 9,011,432 D451G probably damaging Het
Cd19 C T 7: 126,412,109 C301Y probably damaging Het
Cdh23 T C 10: 60,534,423 T198A probably benign Het
Cdt1 T C 8: 122,571,756 S407P probably benign Het
Cyp26c1 A G 19: 37,685,779 T34A probably damaging Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Doxl2 A G 6: 48,978,167 E647G possibly damaging Het
Eif5 T A 12: 111,539,884 C52* probably null Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fhod3 A G 18: 25,110,221 Y1212C probably damaging Het
Ggh T A 4: 20,046,225 F44L probably benign Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm21095 A G Y: 84,120,684 N149S probably damaging Het
Gys2 T A 6: 142,455,141 H311L probably damaging Het
Hcn4 C T 9: 58,857,798 R558C unknown Het
Heatr6 T C 11: 83,769,672 L546P probably damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Lpin1 C T 12: 16,553,962 G623S probably benign Het
Lrfn2 A G 17: 49,070,536 D215G probably damaging Het
Lrrc3c C A 11: 98,599,033 S72* probably null Het
Me3 G A 7: 89,632,900 probably benign Het
Msln A G 17: 25,750,724 I344T probably damaging Het
Olfr1040 A T 2: 86,145,930 L268Q possibly damaging Het
Olfr481 T C 7: 108,081,549 Y252H probably benign Het
Oma1 G A 4: 103,319,374 V112I probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pdgfra A G 5: 75,181,083 N659S probably damaging Het
Rmnd5a A T 6: 71,399,125 probably null Het
Slc6a15 G A 10: 103,409,787 V544M possibly damaging Het
Slco5a1 T A 1: 12,879,223 T648S probably damaging Het
Snx13 T C 12: 35,144,220 F921L probably damaging Het
Stard6 A C 18: 70,483,534 D88A probably damaging Het
Svep1 G T 4: 58,068,886 H2967N possibly damaging Het
Tcaf2 A C 6: 42,626,437 Y730D probably damaging Het
Tes G A 6: 17,097,408 V172M possibly damaging Het
Ttc3 T A 16: 94,466,877 probably benign Het
Vmn1r23 A G 6: 57,925,929 I288T probably benign Het
Vmn1r38 G T 6: 66,777,032 H33Q probably benign Het
Vmn2r75 G T 7: 86,148,141 C821* probably null Het
Zfp282 C T 6: 47,890,633 P248S probably benign Het
Zfp655 T A 5: 145,244,697 I455N probably benign Het
Other mutations in Slc12a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Slc12a8 APN 16 33540897 missense probably damaging 1.00
IGL01701:Slc12a8 APN 16 33540910 missense probably damaging 1.00
IGL02024:Slc12a8 APN 16 33608198 missense probably damaging 1.00
IGL02223:Slc12a8 APN 16 33624690 missense probably damaging 1.00
IGL02637:Slc12a8 APN 16 33534960 missense probably benign 0.05
IGL03248:Slc12a8 APN 16 33551027 missense probably damaging 1.00
R0136:Slc12a8 UTSW 16 33608213 missense probably damaging 1.00
R0436:Slc12a8 UTSW 16 33551085 missense probably damaging 1.00
R0586:Slc12a8 UTSW 16 33658230 missense possibly damaging 0.87
R0669:Slc12a8 UTSW 16 33550904 missense possibly damaging 0.91
R0780:Slc12a8 UTSW 16 33646665 splice site probably null
R1170:Slc12a8 UTSW 16 33662977 missense probably damaging 1.00
R1383:Slc12a8 UTSW 16 33534987 missense probably damaging 1.00
R1707:Slc12a8 UTSW 16 33551007 missense probably damaging 1.00
R2917:Slc12a8 UTSW 16 33550926 missense probably damaging 1.00
R4092:Slc12a8 UTSW 16 33617121 missense probably damaging 1.00
R4604:Slc12a8 UTSW 16 33608159 missense probably damaging 1.00
R4638:Slc12a8 UTSW 16 33590323 missense possibly damaging 0.95
R4908:Slc12a8 UTSW 16 33606259 splice site probably null
R5148:Slc12a8 UTSW 16 33624918 missense probably benign 0.00
R5186:Slc12a8 UTSW 16 33617208 missense probably damaging 1.00
R5711:Slc12a8 UTSW 16 33590309 missense probably damaging 1.00
R5760:Slc12a8 UTSW 16 33624785 nonsense probably null
R6122:Slc12a8 UTSW 16 33625014 missense probably damaging 0.99
R6592:Slc12a8 UTSW 16 33617256 critical splice donor site probably null
R6995:Slc12a8 UTSW 16 33534893 nonsense probably null
R7602:Slc12a8 UTSW 16 33625124 missense probably benign 0.00
R7772:Slc12a8 UTSW 16 33550965 missense probably damaging 1.00
R7849:Slc12a8 UTSW 16 33624560 missense probably damaging 1.00
R7932:Slc12a8 UTSW 16 33624560 missense probably damaging 1.00
R8022:Slc12a8 UTSW 16 33625086 missense not run
Z1176:Slc12a8 UTSW 16 33540965 frame shift probably null
Z1176:Slc12a8 UTSW 16 33606173 missense not run
Predicted Primers PCR Primer
(F):5'- TGATGCTTCCTCCCAGACAG -3'
(R):5'- CACATGATTAGGACCAGCCC -3'

Sequencing Primer
(F):5'- CAGACAGTGGAGGTATCACC -3'
(R):5'- CACCCTAGTCAGAGGTACAGC -3'
Posted On2015-08-18