Mutagenetix > Incidental Mutations

Incidental Mutation 'R0107:Ptprz1'

33317

Institutional Source

Beutler Lab

Gene Symbol

Ptprz1

Ensembl Gene

ENSMUSG00000068748

Gene Name

protein tyrosine phosphatase, receptor type Z, polypeptide 1

Synonyms

PTPzeta, RPTPz, phosphacan, Rptpbeta, DSD-1-PG, PTPbeta, Ptprz, Ptpz

MMRRC Submission

038393-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.566) question?

Stock #

R0107 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

22875502-23052916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23000570 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 886 (D886E)

Ref Sequence

ENSEMBL: ENSMUSP00000088056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090568] [ENSMUST00000202102] [ENSMUST00000202579]

Predicted Effect

probably damaging
Transcript: ENSMUST00000090568
AA Change: D886E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000088056
Gene: ENSMUSG00000068748
AA Change: D886E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Carb_anhydrase	38	300	5.12e-99	SMART
FN3	312	397	5.53e-4	SMART
low complexity region	588	609	N/A	INTRINSIC
low complexity region	825	837	N/A	INTRINSIC
low complexity region	1417	1441	N/A	INTRINSIC
low complexity region	1485	1495	N/A	INTRINSIC
Blast:PTPc	1497	1573	1e-12	BLAST
low complexity region	1606	1620	N/A	INTRINSIC
transmembrane domain	1637	1659	N/A	INTRINSIC
low complexity region	1679	1693	N/A	INTRINSIC
PTPc	1720	1991	2.8e-130	SMART
PTPc	2019	2281	1.65e-77	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201827

Predicted Effect

probably benign
Transcript: ENSMUST00000202102

SMART Domains

Protein: ENSMUSP00000143902
Gene: ENSMUSG00000068748

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Carb_anhydrase	38	300	5.12e-99	SMART
FN3	312	397	5.53e-4	SMART
low complexity region	588	609	N/A	INTRINSIC
transmembrane domain	788	810	N/A	INTRINSIC
low complexity region	830	844	N/A	INTRINSIC
PTPc	871	1142	2.8e-130	SMART
PTPc	1170	1432	1.65e-77	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202579
AA Change: D886E

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144605
Gene: ENSMUSG00000068748
AA Change: D886E

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Carb_anhydrase	38	300	4e-103	SMART
FN3	312	397	2.8e-6	SMART
low complexity region	588	609	N/A	INTRINSIC
low complexity region	825	837	N/A	INTRINSIC
low complexity region	1417	1441	N/A	INTRINSIC
low complexity region	1485	1495	N/A	INTRINSIC

Meta Mutation Damage Score

0.0656

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.6%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for targeted null mutations demonstrate an impaired ability to recover from inflamatory lesions of the CNS or gastric mucosa. Mice homozygous for a knock-out allele exhibit increased tactile and thermal nociception thresholds. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,080,834	V825A	probably benign	Het
Adamts7	T	C	9: 90,180,720	I409T	possibly damaging	Het
Adck1	T	C	12: 88,446,656	W253R	possibly damaging	Het
Afg3l2	A	G	18: 67,431,766	F213L	probably damaging	Het
Ankle2	T	C	5: 110,253,027	V743A	probably benign	Het
Ankrd34c	C	T	9: 89,729,484	R268H	probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc7b	T	G	8: 129,178,197		probably benign	Het
Cd320	A	T	17: 33,848,085	M169L	probably benign	Het
Chn1	A	G	2: 73,614,684	Y338H	probably damaging	Het
Chuk	T	A	19: 44,096,919	S263C	probably damaging	Het
Dennd4b	C	A	3: 90,272,736	P663T	possibly damaging	Het
Dnajc24	T	G	2: 106,001,914		probably benign	Het
Fam172a	A	G	13: 77,902,814	D145G	probably damaging	Het
Fbn2	A	G	18: 58,056,203	V1617A	probably benign	Het
Fermt2	T	C	14: 45,464,822	N502D	probably damaging	Het
Frrs1	A	T	3: 116,896,716	I3F	probably damaging	Het
Fut1	C	A	7: 45,618,846	Q20K	possibly damaging	Het
Gbf1	T	C	19: 46,284,828	V1709A	probably benign	Het
Gfra3	G	T	18: 34,711,306	H60Q	probably benign	Het
Gm10750	T	A	2: 149,016,053	M93L	unknown	Het
Gm5538	T	A	3: 59,752,316	L397I	possibly damaging	Het
Hmcn1	T	A	1: 150,587,015	I5124L	probably benign	Het
Hps3	A	C	3: 20,030,796	L76R	probably damaging	Het
Ifrd1	T	A	12: 40,214,081	Q105L	probably damaging	Het
Irs2	A	T	8: 11,004,691	V1247E	probably damaging	Het
Itgal	T	C	7: 127,328,559		probably benign	Het
Ivns1abp	A	T	1: 151,361,570	N495I	probably damaging	Het
Kank1	T	A	19: 25,430,366		probably benign	Het
Mroh8	T	C	2: 157,225,468	Q657R	probably benign	Het
Mthfd1l	T	C	10: 4,041,838	Y597H	probably benign	Het
Myom1	G	A	17: 71,077,365	V692I	probably damaging	Het
Olfr347	T	G	2: 36,734,718	Y132*	probably null	Het
Olfr45	A	T	7: 140,691,345	M147L	probably benign	Het
Olfr835	A	G	9: 19,035,333	D70G	probably damaging	Het
Palmd	A	T	3: 116,924,076	H257Q	probably damaging	Het
Pcnx2	A	T	8: 125,753,586	V1994D	probably benign	Het
Phkb	G	A	8: 86,016,931	G553S	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Ptprn	A	T	1: 75,255,712	L453M	probably damaging	Het
Rcn1	T	A	2: 105,394,781	I110F	possibly damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Slc6a19	A	G	13: 73,684,057	Y467H	possibly damaging	Het
Slc9c1	T	A	16: 45,575,420	D611E	probably benign	Het
Slitrk6	T	C	14: 110,751,963	E104G	possibly damaging	Het
Spag17	A	T	3: 100,050,787	K920N	possibly damaging	Het
St3gal5	A	G	6: 72,142,149	S82G	probably benign	Het
Tlk1	T	C	2: 70,713,989	*767W	probably null	Het
Tln2	A	G	9: 67,370,706	V342A	probably damaging	Het
Tmem104	T	A	11: 115,202,180	M132K	probably damaging	Het
Tmem184c	A	G	8: 77,597,073	S387P	possibly damaging	Het
Tmtc1	A	G	6: 148,425,913	V34A	possibly damaging	Het
Trim46	A	G	3: 89,236,333	F596S	probably damaging	Het
Unc79	T	A	12: 103,134,525	D1870E	possibly damaging	Het
Utp20	T	C	10: 88,778,391	T1234A	probably benign	Het
Vmn1r31	T	A	6: 58,472,743	T46S	probably benign	Het
Vps13a	A	T	19: 16,691,824	L1341Q	probably benign	Het
Wdr72	A	T	9: 74,210,433	D821V	probably damaging	Het
Zfhx4	T	C	3: 5,398,982	L1400P	probably damaging	Het
Zfp217	T	A	2: 170,114,874	K735*	probably null	Het
Zfp235	A	G	7: 24,137,116	Q29R	probably damaging	Het
Zfp628	A	G	7: 4,920,168	Y463C	probably damaging	Het
Zkscan4	A	G	13: 21,484,581	T401A	possibly damaging	Het

Other mutations in Ptprz1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Ptprz1	APN	6	22973054	missense	probably damaging	1.00
IGL00773:Ptprz1	APN	6	23002629	missense	probably benign	0.41
IGL01458:Ptprz1	APN	6	22972844	missense	probably damaging	0.99
IGL01481:Ptprz1	APN	6	22999980	missense	probably benign	0.05
IGL01501:Ptprz1	APN	6	22973082	missense	probably damaging	1.00
IGL01601:Ptprz1	APN	6	23000438	missense	probably damaging	0.99
IGL01882:Ptprz1	APN	6	23000464	missense	probably damaging	1.00
IGL02058:Ptprz1	APN	6	23002503	missense	probably benign	0.00
IGL02089:Ptprz1	APN	6	23033448	missense	probably damaging	1.00
IGL02136:Ptprz1	APN	6	22972822	missense	probably damaging	1.00
IGL02215:Ptprz1	APN	6	22965182	missense	possibly damaging	0.91
IGL02220:Ptprz1	APN	6	23042743	splice site	probably benign
IGL02556:Ptprz1	APN	6	22972845	missense	probably benign	0.01
IGL02601:Ptprz1	APN	6	23000687	missense	probably benign	0.11
IGL02620:Ptprz1	APN	6	22959740	missense	probably damaging	1.00
IGL02666:Ptprz1	APN	6	23001210	missense	probably benign	0.00
IGL02718:Ptprz1	APN	6	23001349	missense	possibly damaging	0.77
IGL02792:Ptprz1	APN	6	22959723	missense	probably damaging	1.00
IGL02894:Ptprz1	APN	6	23035149	missense	probably damaging	1.00
IGL02952:Ptprz1	APN	6	23036926	missense	probably damaging	1.00
IGL03003:Ptprz1	APN	6	23002583	missense	probably damaging	0.98
IGL03060:Ptprz1	APN	6	22972835	missense	probably damaging	1.00
IGL03170:Ptprz1	APN	6	22959767	missense	probably benign	0.00
IGL03246:Ptprz1	APN	6	22986160	missense	probably damaging	0.99
IGL03349:Ptprz1	APN	6	23000332	missense	probably damaging	1.00
IGL03365:Ptprz1	APN	6	23030582	splice site	probably benign
R0044:Ptprz1	UTSW	6	23007403	missense	probably damaging	1.00
R0054:Ptprz1	UTSW	6	22986196	missense	probably damaging	1.00
R0054:Ptprz1	UTSW	6	22986196	missense	probably damaging	1.00
R0278:Ptprz1	UTSW	6	23000817	missense	probably benign	0.31
R0345:Ptprz1	UTSW	6	23016165	missense	probably damaging	1.00
R0359:Ptprz1	UTSW	6	22973176	splice site	probably benign
R0743:Ptprz1	UTSW	6	23044367	nonsense	probably null
R1014:Ptprz1	UTSW	6	23000644	missense	probably damaging	1.00
R1016:Ptprz1	UTSW	6	23000974	missense	probably damaging	1.00
R1106:Ptprz1	UTSW	6	22965749	missense	probably damaging	0.99
R1391:Ptprz1	UTSW	6	23001729	missense	probably benign	0.33
R1424:Ptprz1	UTSW	6	23000383	missense	probably benign	0.00
R1445:Ptprz1	UTSW	6	23050474	missense	probably damaging	1.00
R1496:Ptprz1	UTSW	6	23049524	splice site	probably benign
R1544:Ptprz1	UTSW	6	23000748	missense	possibly damaging	0.63
R1626:Ptprz1	UTSW	6	23001574	missense	probably benign
R1641:Ptprz1	UTSW	6	23049606	missense	probably damaging	1.00
R1757:Ptprz1	UTSW	6	23044320	missense	probably damaging	1.00
R1812:Ptprz1	UTSW	6	22959712	missense	probably benign	0.07
R1917:Ptprz1	UTSW	6	23035040	splice site	probably benign
R1930:Ptprz1	UTSW	6	23007355	missense	probably damaging	1.00
R1931:Ptprz1	UTSW	6	23007355	missense	probably damaging	1.00
R1974:Ptprz1	UTSW	6	22986311	missense	probably damaging	1.00
R1992:Ptprz1	UTSW	6	22959748	missense	probably benign	0.24
R1997:Ptprz1	UTSW	6	23050497	missense	probably damaging	0.99
R2002:Ptprz1	UTSW	6	23027834	nonsense	probably null
R2012:Ptprz1	UTSW	6	23001027	missense	probably benign	0.03
R2059:Ptprz1	UTSW	6	22986323	splice site	probably benign
R2061:Ptprz1	UTSW	6	23049675	critical splice donor site	probably null
R2064:Ptprz1	UTSW	6	23050389	splice site	probably benign
R2067:Ptprz1	UTSW	6	23050389	splice site	probably benign
R2108:Ptprz1	UTSW	6	23033477	missense	probably damaging	0.99
R2152:Ptprz1	UTSW	6	23030671	missense	probably damaging	0.99
R2166:Ptprz1	UTSW	6	23045633	missense	possibly damaging	0.90
R2183:Ptprz1	UTSW	6	23002285	missense	probably benign
R2202:Ptprz1	UTSW	6	23000650	missense	possibly damaging	0.63
R2238:Ptprz1	UTSW	6	22987377	missense	probably damaging	1.00
R2290:Ptprz1	UTSW	6	23000991	missense	probably damaging	1.00
R3027:Ptprz1	UTSW	6	23016197	missense	possibly damaging	0.89
R3861:Ptprz1	UTSW	6	23036895	missense	probably damaging	0.98
R4012:Ptprz1	UTSW	6	23002585	missense	probably damaging	0.99
R4020:Ptprz1	UTSW	6	22959624	splice site	probably benign
R4158:Ptprz1	UTSW	6	23001684	nonsense	probably null
R4158:Ptprz1	UTSW	6	23022205	missense	possibly damaging	0.73
R4159:Ptprz1	UTSW	6	23001684	nonsense	probably null
R4160:Ptprz1	UTSW	6	23022205	missense	possibly damaging	0.73
R4606:Ptprz1	UTSW	6	23001487	missense	possibly damaging	0.80
R4621:Ptprz1	UTSW	6	23001454	missense	possibly damaging	0.68
R4640:Ptprz1	UTSW	6	22972798	missense	probably damaging	1.00
R4731:Ptprz1	UTSW	6	23002610	missense	probably benign	0.06
R4732:Ptprz1	UTSW	6	23002610	missense	probably benign	0.06
R4733:Ptprz1	UTSW	6	23002610	missense	probably benign	0.06
R4803:Ptprz1	UTSW	6	23001546	missense	probably benign	0.00
R4890:Ptprz1	UTSW	6	23024958	missense	probably damaging	1.00
R5035:Ptprz1	UTSW	6	23016215	missense	probably benign	0.06
R5052:Ptprz1	UTSW	6	23045626	missense	probably damaging	1.00
R5106:Ptprz1	UTSW	6	23000028	missense	probably benign	0.04
R5248:Ptprz1	UTSW	6	23001901	missense	probably benign	0.11
R5292:Ptprz1	UTSW	6	23002582	missense	probably benign	0.31
R5373:Ptprz1	UTSW	6	23007355	missense	probably damaging	1.00
R5374:Ptprz1	UTSW	6	23007355	missense	probably damaging	1.00
R5378:Ptprz1	UTSW	6	23007402	missense	probably damaging	1.00
R5408:Ptprz1	UTSW	6	23002600	missense	probably damaging	1.00
R5479:Ptprz1	UTSW	6	23001666	missense	probably benign
R5524:Ptprz1	UTSW	6	22986318	splice site	probably null
R5527:Ptprz1	UTSW	6	23000053	missense	possibly damaging	0.66
R5557:Ptprz1	UTSW	6	23001001	missense	probably benign	0.04
R5654:Ptprz1	UTSW	6	22986134	missense	probably damaging	1.00
R5655:Ptprz1	UTSW	6	22999773	missense	probably benign	0.00
R5658:Ptprz1	UTSW	6	23016189	missense	probably damaging	1.00
R5663:Ptprz1	UTSW	6	23035143	missense	probably damaging	1.00
R5765:Ptprz1	UTSW	6	23000236	missense	probably damaging	1.00
R5822:Ptprz1	UTSW	6	23001445	missense	probably benign	0.01
R5837:Ptprz1	UTSW	6	23001418	missense	probably benign	0.00
R6108:Ptprz1	UTSW	6	23045659	missense	probably damaging	1.00
R6199:Ptprz1	UTSW	6	23002471	missense	probably benign	0.01
R6245:Ptprz1	UTSW	6	23051990	missense	probably damaging	1.00
R6257:Ptprz1	UTSW	6	22959640	missense	probably damaging	1.00
R6488:Ptprz1	UTSW	6	23001517	nonsense	probably null
R6606:Ptprz1	UTSW	6	23002501	missense	probably benign	0.27
R6612:Ptprz1	UTSW	6	23052082	missense	probably damaging	1.00
R6824:Ptprz1	UTSW	6	23002131	missense	probably benign	0.05
R6834:Ptprz1	UTSW	6	22999633	missense	probably benign	0.38
R6836:Ptprz1	UTSW	6	23030665	nonsense	probably null
R6991:Ptprz1	UTSW	6	23002687	missense	probably benign	0.00
R7044:Ptprz1	UTSW	6	23044346	missense	probably damaging	1.00
R7048:Ptprz1	UTSW	6	22961623	missense	probably benign	0.18
R7225:Ptprz1	UTSW	6	23000929	missense	possibly damaging	0.61
R7284:Ptprz1	UTSW	6	23000098	missense	probably damaging	1.00
R7360:Ptprz1	UTSW	6	23000907	missense	probably damaging	1.00
R7501:Ptprz1	UTSW	6	23001747	nonsense	probably null
R7515:Ptprz1	UTSW	6	23022267	missense	probably damaging	1.00
R7538:Ptprz1	UTSW	6	22999896	missense	possibly damaging	0.81
R7567:Ptprz1	UTSW	6	22959780	missense	probably damaging	0.97
R7599:Ptprz1	UTSW	6	23002519	missense	not run
R7611:Ptprz1	UTSW	6	23001220	missense	probably benign
R7685:Ptprz1	UTSW	6	23024978	missense	probably damaging	1.00
R7707:Ptprz1	UTSW	6	23002296	missense	probably benign	0.00
R7733:Ptprz1	UTSW	6	23000384	missense	probably benign	0.31
R7786:Ptprz1	UTSW	6	23036993	missense	probably damaging	1.00
R7868:Ptprz1	UTSW	6	23000964	missense	not run
R7882:Ptprz1	UTSW	6	23002257	missense	probably benign	0.13
R7968:Ptprz1	UTSW	6	22959676	missense	probably damaging	0.98
R8024:Ptprz1	UTSW	6	23042751	missense	probably damaging	1.00
R8157:Ptprz1	UTSW	6	23002540	missense	probably damaging	1.00
R8159:Ptprz1	UTSW	6	23001663	missense	probably benign
Z1176:Ptprz1	UTSW	6	23051995	missense	probably damaging	0.99
Z1177:Ptprz1	UTSW	6	22999840	missense	possibly damaging	0.51
Z1177:Ptprz1	UTSW	6	23052024	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGAAGTCTTTCCTCTAGCCACCC -3'
(R):5'- ACCATGCAGAGGCATTGCAGAAC -3'

Sequencing Primer
(F):5'- GTTGCTTGACAATCAGACCC -3'
(R):5'- CAGAGGCATTGCAGAACTGTAAG -3'

Posted On

2013-05-09