Incidental Mutation 'R0107:St3gal5'
ID33319
Institutional Source Beutler Lab
Gene Symbol St3gal5
Ensembl Gene ENSMUSG00000056091
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 5
SynonymsGM3-specific sialytransferase, 3S-T, mST3Gal V, ST3Gal V, GM3 synthase, Siat9, [a]2
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0107 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location72097592-72154571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72142149 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 82 (S82G)
Ref Sequence ENSEMBL: ENSMUSP00000145599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069994] [ENSMUST00000114112] [ENSMUST00000188366]
Predicted Effect probably benign
Transcript: ENSMUST00000069994
AA Change: S109G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000070414
Gene: ENSMUSG00000056091
AA Change: S109G

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:Glyco_transf_29 141 411 3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114112
AA Change: S82G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109747
Gene: ENSMUSG00000056091
AA Change: S82G

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Glyco_transf_29 111 385 4.9e-71 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000187007
AA Change: S83G
Predicted Effect probably benign
Transcript: ENSMUST00000188366
AA Change: S82G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ganglioside GM3 is known to participate in the induction of cell differentiation, modulation of cell proliferation, maintenance of fibroblast morphology, signal transduction, and integrin-mediated cell adhesion. The protein encoded by this gene is a type II membrane protein which catalyzes the formation of GM3 using lactosylceramide as the substrate. The encoded protein is a member of glycosyltransferase family 29 and may be localized to the Golgi apparatus. Mutation in this gene has been associated with Amish infantile epilepsy syndrome. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene leads to inability to synthesize GM3 ganglioside. Homozygotes for a null allele exhibit enhanced sensitivity to insulin. Homozygotes for a different null allele show resistance to botulinum neurotoxin type C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in St3gal5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:St3gal5 APN 6 72128282 missense probably benign 0.00
IGL02277:St3gal5 APN 6 72142200 missense possibly damaging 0.50
IGL02756:St3gal5 APN 6 72149173 missense probably null 0.83
IGL02904:St3gal5 APN 6 72147124 missense possibly damaging 0.94
R1605:St3gal5 UTSW 6 72142288 missense probably benign 0.42
R1854:St3gal5 UTSW 6 72132093 missense probably damaging 1.00
R2875:St3gal5 UTSW 6 72147130 missense possibly damaging 0.96
R3692:St3gal5 UTSW 6 72149029 missense probably benign 0.05
R5071:St3gal5 UTSW 6 72132053 missense probably damaging 1.00
R5265:St3gal5 UTSW 6 72149131 missense probably damaging 1.00
R5609:St3gal5 UTSW 6 72153462 missense possibly damaging 0.75
R8085:St3gal5 UTSW 6 72097941 missense unknown
R8199:St3gal5 UTSW 6 72142191 missense probably benign
R8251:St3gal5 UTSW 6 72149160 missense probably benign 0.03
R8294:St3gal5 UTSW 6 72097832 missense
R8332:St3gal5 UTSW 6 72142181 nonsense probably null
R8410:St3gal5 UTSW 6 72142297 missense probably benign 0.00
RF060:St3gal5 UTSW 6 72097852 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAGCATTGCAACATGCCAAGC -3'
(R):5'- CGGAATCCAAAAGGCGGGTCATAC -3'

Sequencing Primer
(F):5'- agcatctttacctactgagcc -3'
(R):5'- AGGCGGGTCATACTTGAGC -3'
Posted On2013-05-09