Mutagenetix > Incidental Mutations

Incidental Mutation 'R4533:Vmn2r72'

333200

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r72

Ensembl Gene

ENSMUSG00000051877

Gene Name

vomeronasal 2, receptor 72

Synonyms

Vmn2r72-ps, EG244114

MMRRC Submission

041773-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R4533 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85737784-85754981 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85751926 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 95 (H95L)

Ref Sequence

ENSEMBL: ENSMUSP00000133014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063425]

Predicted Effect

probably benign
Transcript: ENSMUST00000063425
AA Change: H95L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: H95L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	82	469	2.3e-28	PFAM
Pfam:NCD3G	512	564	1.2e-18	PFAM
Pfam:7tm_3	594	832	4e-53	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (54/54)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts7	A	G	9: 90,180,708	Y405C	probably damaging	Het
Ago3	A	T	4: 126,345,563	S832T	probably damaging	Het
Akap9	T	A	5: 4,043,948	F2157I	probably damaging	Het
Anapc5	T	C	5: 122,791,735	E561G	possibly damaging	Het
Art5	T	C	7: 102,098,338	H78R	probably benign	Het
Blvra	T	A	2: 127,090,384		probably null	Het
Ccdc171	A	G	4: 83,657,342	T488A	possibly damaging	Het
Crtc3	A	T	7: 80,589,795	M603K	probably damaging	Het
Csmd1	T	C	8: 15,931,037		probably null	Het
Dbh	C	A	2: 27,177,331	H409Q	possibly damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Gm12185	T	C	11: 48,907,920	Y582C	probably damaging	Het
Gm12185	T	C	11: 48,908,094	N524S	possibly damaging	Het
Gm7356	A	C	17: 14,001,410	I119R	probably damaging	Het
Heatr1	T	A	13: 12,434,511	D1963E	probably benign	Het
Ighv1-37	A	T	12: 114,896,527	V21D	probably damaging	Het
Itga3	T	G	11: 95,057,293	Q602P	probably benign	Het
Kcmf1	G	A	6: 72,849,591	R152C	probably damaging	Het
Lin54	T	C	5: 100,485,403	I141V	possibly damaging	Het
Mast1	T	A	8: 84,921,361	H497L	probably damaging	Het
Mrpl44	T	C	1: 79,776,254	F41S	possibly damaging	Het
Myo18b	T	C	5: 112,693,025	R2301G	probably damaging	Het
Nek1	A	T	8: 61,007,213	M58L	possibly damaging	Het
Olfr726	T	C	14: 50,083,699		probably null	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
P3h3	A	G	6: 124,854,408	V338A	possibly damaging	Het
Pcdha7	T	C	18: 36,975,407	V495A	possibly damaging	Het
Plcb3	T	C	19: 6,956,272	E895G	probably benign	Het
Plekha5	A	G	6: 140,570,331	E770G	probably damaging	Het
Ptchd3	C	T	11: 121,836,431	S377F	probably damaging	Het
Ptprj	C	T	2: 90,439,955	D1266N	probably damaging	Het
Raly	A	T	2: 154,865,933	E291V	probably damaging	Het
Rnf217	C	A	10: 31,608,763	C141F	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc12a3	A	G	8: 94,357,086	M914V	probably null	Het
Tbc1d9	A	G	8: 83,270,918	T1035A	probably damaging	Het
Tex14	C	T	11: 87,536,829	R36*	probably null	Het
Tiparp	A	G	3: 65,546,347	D172G	probably benign	Het
Ttc3	T	A	16: 94,466,877		probably benign	Het
Uap1	A	T	1: 170,143,425	I466N	probably damaging	Het
Ubr1	T	C	2: 120,942,482	T426A	possibly damaging	Het
Vmn1r77	T	A	7: 12,041,829	H177Q	probably benign	Het
Vwc2l	G	A	1: 70,882,139	C151Y	probably damaging	Het
Wdr12	T	C	1: 60,078,195	Y414C	probably benign	Het
Zfp609	A	C	9: 65,703,608	V691G	probably benign	Het
Zmiz1	T	C	14: 25,645,660	Y254H	probably damaging	Het

Other mutations in Vmn2r72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Vmn2r72	APN	7	85749646	missense	probably benign	0.01
IGL01019:Vmn2r72	APN	7	85738334	missense	probably benign	0.26
IGL01445:Vmn2r72	APN	7	85749646	missense	probably benign	0.06
IGL02076:Vmn2r72	APN	7	85738367	missense	probably damaging	1.00
IGL02082:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02086:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02089:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02125:Vmn2r72	APN	7	85750711	missense	probably benign	0.00
IGL02146:Vmn2r72	APN	7	85737962	missense	probably damaging	1.00
IGL02272:Vmn2r72	APN	7	85750693	missense	probably benign
IGL02514:Vmn2r72	APN	7	85738699	missense	possibly damaging	0.90
IGL02662:Vmn2r72	APN	7	85738183	missense	probably benign	0.26
IGL02697:Vmn2r72	APN	7	85738671	missense	probably benign	0.36
IGL02733:Vmn2r72	APN	7	85751813	missense	probably benign	0.05
IGL03070:Vmn2r72	APN	7	85752041	splice site	probably benign
IGL03150:Vmn2r72	APN	7	85751176	missense	probably damaging	1.00
IGL03159:Vmn2r72	APN	7	85754954	missense	probably benign	0.05
IGL03333:Vmn2r72	APN	7	85750867	missense	probably benign	0.10
R0081:Vmn2r72	UTSW	7	85751836	missense	probably benign	0.01
R0090:Vmn2r72	UTSW	7	85754876	missense	probably benign
R0655:Vmn2r72	UTSW	7	85738111	nonsense	probably null
R0778:Vmn2r72	UTSW	7	85749739	missense	probably benign	0.00
R1169:Vmn2r72	UTSW	7	85751309	missense	probably benign	0.01
R1172:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1173:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1175:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1248:Vmn2r72	UTSW	7	85749188	missense	probably benign	0.02
R1302:Vmn2r72	UTSW	7	85738257	missense	probably damaging	1.00
R1506:Vmn2r72	UTSW	7	85749211	missense	probably benign
R1632:Vmn2r72	UTSW	7	85751792	missense	probably benign	0.13
R1775:Vmn2r72	UTSW	7	85738170	missense	probably benign	0.01
R1962:Vmn2r72	UTSW	7	85749161	missense	probably benign	0.00
R2201:Vmn2r72	UTSW	7	85738236	missense	probably benign	0.12
R2290:Vmn2r72	UTSW	7	85738341	missense	probably damaging	1.00
R2327:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R2424:Vmn2r72	UTSW	7	85750953	missense	probably damaging	1.00
R2655:Vmn2r72	UTSW	7	85751269	missense	possibly damaging	0.95
R2860:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2861:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2862:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R3009:Vmn2r72	UTSW	7	85749642	missense	probably benign	0.00
R3797:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3798:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3902:Vmn2r72	UTSW	7	85749735	missense	possibly damaging	0.52
R3959:Vmn2r72	UTSW	7	85751131	missense	probably benign	0.36
R3974:Vmn2r72	UTSW	7	85749809	missense	probably damaging	1.00
R4399:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4421:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4426:Vmn2r72	UTSW	7	85737828	nonsense	probably null
R4522:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4523:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4691:Vmn2r72	UTSW	7	85737911	nonsense	probably null
R4781:Vmn2r72	UTSW	7	85737861	missense	probably benign	0.14
R4863:Vmn2r72	UTSW	7	85750598	missense	possibly damaging	0.91
R4952:Vmn2r72	UTSW	7	85751109	missense	probably benign
R4991:Vmn2r72	UTSW	7	85751130	missense	probably damaging	0.99
R4995:Vmn2r72	UTSW	7	85738485	missense	probably damaging	1.00
R5095:Vmn2r72	UTSW	7	85737853	missense	probably damaging	0.98
R5174:Vmn2r72	UTSW	7	85737840	missense	probably benign	0.00
R5276:Vmn2r72	UTSW	7	85738254	missense	possibly damaging	0.90
R5395:Vmn2r72	UTSW	7	85750897	missense	possibly damaging	0.71
R5560:Vmn2r72	UTSW	7	85751942	missense	probably damaging	0.96
R5933:Vmn2r72	UTSW	7	85737850	missense	probably benign	0.05
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6354:Vmn2r72	UTSW	7	85750539	critical splice donor site	probably null
R6362:Vmn2r72	UTSW	7	85751174	missense	probably damaging	1.00
R6594:Vmn2r72	UTSW	7	85749684	missense	probably benign	0.32
R6794:Vmn2r72	UTSW	7	85737996	missense	probably damaging	1.00
R7113:Vmn2r72	UTSW	7	85749803	synonymous	probably null
R7189:Vmn2r72	UTSW	7	85754917	missense	probably benign	0.36
R7266:Vmn2r72	UTSW	7	85738274	nonsense	probably null
R7323:Vmn2r72	UTSW	7	85750563	missense	probably benign
R7426:Vmn2r72	UTSW	7	85751140	missense	probably benign
R7606:Vmn2r72	UTSW	7	85751154	missense	possibly damaging	0.91
R7651:Vmn2r72	UTSW	7	85751938	missense	probably damaging	1.00
R7688:Vmn2r72	UTSW	7	85754890	missense	probably benign	0.32
R7753:Vmn2r72	UTSW	7	85750626	missense	probably damaging	1.00
R7843:Vmn2r72	UTSW	7	85749630	missense	probably benign	0.01
R7926:Vmn2r72	UTSW	7	85749630	missense	probably benign	0.01
Z1176:Vmn2r72	UTSW	7	85749191	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGCTATACATGAACATGAGTGGTC -3'
(R):5'- CCCTTTTCTGTCAGTTAAAACCAGTAC -3'

Sequencing Primer
(F):5'- CATGAACATGAGTGGTCCTAGTC -3'
(R):5'- TGGCTCTTGCTTGTACAG -3'

Posted On

2015-08-18