Mutagenetix > Incidental Mutations

Incidental Mutation 'R4533:Mast1'

333205

Institutional Source

Beutler Lab

Gene Symbol

Mast1

Ensembl Gene

ENSMUSG00000053693

Gene Name

microtubule associated serine/threonine kinase 1

Synonyms

SAST170, SAST, 9430008B02Rik

MMRRC Submission

041773-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4533 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84911903-84937359 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84921361 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 497 (H497L)

Ref Sequence

ENSEMBL: ENSMUSP00000105363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]

Predicted Effect

probably damaging
Transcript: ENSMUST00000109741
AA Change: H497L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: H497L

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	337	1.4e-136	PFAM
S_TKc	376	649	4.07e-97	SMART
S_TK_X	650	710	6.23e-2	SMART
low complexity region	820	836	N/A	INTRINSIC
low complexity region	863	878	N/A	INTRINSIC
low complexity region	933	961	N/A	INTRINSIC
PDZ	977	1057	3.49e-14	SMART
low complexity region	1104	1132	N/A	INTRINSIC
low complexity region	1149	1174	N/A	INTRINSIC
low complexity region	1212	1224	N/A	INTRINSIC
low complexity region	1243	1252	N/A	INTRINSIC
low complexity region	1479	1492	N/A	INTRINSIC
low complexity region	1519	1535	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119820
AA Change: H497L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693
AA Change: H497L

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	338	5.1e-148	PFAM
S_TKc	376	644	2.79e-86	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130923

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175085

Meta Mutation Damage Score

0.9641

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (54/54)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts7	A	G	9: 90,180,708	Y405C	probably damaging	Het
Ago3	A	T	4: 126,345,563	S832T	probably damaging	Het
Akap9	T	A	5: 4,043,948	F2157I	probably damaging	Het
Anapc5	T	C	5: 122,791,735	E561G	possibly damaging	Het
Art5	T	C	7: 102,098,338	H78R	probably benign	Het
Blvra	T	A	2: 127,090,384		probably null	Het
Ccdc171	A	G	4: 83,657,342	T488A	possibly damaging	Het
Crtc3	A	T	7: 80,589,795	M603K	probably damaging	Het
Csmd1	T	C	8: 15,931,037		probably null	Het
Dbh	C	A	2: 27,177,331	H409Q	possibly damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Gm12185	T	C	11: 48,907,920	Y582C	probably damaging	Het
Gm12185	T	C	11: 48,908,094	N524S	possibly damaging	Het
Gm7356	A	C	17: 14,001,410	I119R	probably damaging	Het
Heatr1	T	A	13: 12,434,511	D1963E	probably benign	Het
Ighv1-37	A	T	12: 114,896,527	V21D	probably damaging	Het
Itga3	T	G	11: 95,057,293	Q602P	probably benign	Het
Kcmf1	G	A	6: 72,849,591	R152C	probably damaging	Het
Lin54	T	C	5: 100,485,403	I141V	possibly damaging	Het
Mrpl44	T	C	1: 79,776,254	F41S	possibly damaging	Het
Myo18b	T	C	5: 112,693,025	R2301G	probably damaging	Het
Nek1	A	T	8: 61,007,213	M58L	possibly damaging	Het
Olfr726	T	C	14: 50,083,699		probably null	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
P3h3	A	G	6: 124,854,408	V338A	possibly damaging	Het
Pcdha7	T	C	18: 36,975,407	V495A	possibly damaging	Het
Plcb3	T	C	19: 6,956,272	E895G	probably benign	Het
Plekha5	A	G	6: 140,570,331	E770G	probably damaging	Het
Ptchd3	C	T	11: 121,836,431	S377F	probably damaging	Het
Ptprj	C	T	2: 90,439,955	D1266N	probably damaging	Het
Raly	A	T	2: 154,865,933	E291V	probably damaging	Het
Rnf217	C	A	10: 31,608,763	C141F	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc12a3	A	G	8: 94,357,086	M914V	probably null	Het
Tbc1d9	A	G	8: 83,270,918	T1035A	probably damaging	Het
Tex14	C	T	11: 87,536,829	R36*	probably null	Het
Tiparp	A	G	3: 65,546,347	D172G	probably benign	Het
Ttc3	T	A	16: 94,466,877		probably benign	Het
Uap1	A	T	1: 170,143,425	I466N	probably damaging	Het
Ubr1	T	C	2: 120,942,482	T426A	possibly damaging	Het
Vmn1r77	T	A	7: 12,041,829	H177Q	probably benign	Het
Vmn2r72	T	A	7: 85,751,926	H95L	probably benign	Het
Vwc2l	G	A	1: 70,882,139	C151Y	probably damaging	Het
Wdr12	T	C	1: 60,078,195	Y414C	probably benign	Het
Zfp609	A	C	9: 65,703,608	V691G	probably benign	Het
Zmiz1	T	C	14: 25,645,660	Y254H	probably damaging	Het

Other mutations in Mast1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Mast1	APN	8	84912815	missense	possibly damaging	0.87
IGL01862:Mast1	APN	8	84913246	intron	probably null
IGL01918:Mast1	APN	8	84921209	missense	probably damaging	1.00
IGL02212:Mast1	APN	8	84921397	missense	probably damaging	1.00
IGL02221:Mast1	APN	8	84918755	missense	possibly damaging	0.92
IGL02370:Mast1	APN	8	84912254	missense	probably benign
IGL02470:Mast1	APN	8	84921212	missense	probably damaging	1.00
IGL02596:Mast1	APN	8	84917771	missense	probably benign
IGL02716:Mast1	APN	8	84935723	missense	probably damaging	1.00
IGL02987:Mast1	APN	8	84925719	missense	possibly damaging	0.75
IGL03287:Mast1	APN	8	84913353	missense	probably benign	0.01
R0255:Mast1	UTSW	8	84912021	missense	probably benign
R0388:Mast1	UTSW	8	84915537	missense	probably benign	0.13
R0480:Mast1	UTSW	8	84913089	missense	probably damaging	0.99
R0727:Mast1	UTSW	8	84921415	missense	probably damaging	1.00
R1175:Mast1	UTSW	8	84925327	missense	probably benign	0.29
R1297:Mast1	UTSW	8	84912716	missense	probably benign	0.05
R1328:Mast1	UTSW	8	84917988	intron	probably benign
R1454:Mast1	UTSW	8	84920635	missense	probably damaging	1.00
R1532:Mast1	UTSW	8	84928609	nonsense	probably null
R1752:Mast1	UTSW	8	84925336	missense	probably benign
R1777:Mast1	UTSW	8	84912068	missense	probably benign
R1905:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1906:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1907:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R2056:Mast1	UTSW	8	84920366	missense	possibly damaging	0.95
R2071:Mast1	UTSW	8	84921194	missense	probably damaging	1.00
R2145:Mast1	UTSW	8	84921478	missense	probably damaging	1.00
R2318:Mast1	UTSW	8	84921125	missense	probably damaging	1.00
R2842:Mast1	UTSW	8	84923908	missense	probably damaging	1.00
R3870:Mast1	UTSW	8	84918731	missense	probably damaging	1.00
R3895:Mast1	UTSW	8	84935723	missense	probably damaging	1.00
R3973:Mast1	UTSW	8	84918764	missense	probably damaging	1.00
R4405:Mast1	UTSW	8	84920891	missense	probably damaging	1.00
R4725:Mast1	UTSW	8	84929006	missense	possibly damaging	0.93
R4770:Mast1	UTSW	8	84929246	missense	probably benign	0.02
R4776:Mast1	UTSW	8	84937193	critical splice donor site	probably null
R4835:Mast1	UTSW	8	84923779	missense	probably damaging	1.00
R4871:Mast1	UTSW	8	84920658	missense	probably damaging	1.00
R4953:Mast1	UTSW	8	84918728	missense	probably damaging	0.99
R4960:Mast1	UTSW	8	84917871	missense	probably benign
R4978:Mast1	UTSW	8	84935787	missense	probably damaging	0.98
R5164:Mast1	UTSW	8	84913518	unclassified	probably benign
R5235:Mast1	UTSW	8	84913439	missense	probably damaging	1.00
R5297:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R5463:Mast1	UTSW	8	84925507	missense	probably damaging	1.00
R5546:Mast1	UTSW	8	84916260	missense	probably damaging	1.00
R5651:Mast1	UTSW	8	84928968	nonsense	probably null
R6124:Mast1	UTSW	8	84925307	missense	probably benign	0.01
R6213:Mast1	UTSW	8	84915569	missense	probably damaging	1.00
R6717:Mast1	UTSW	8	84917754	missense	probably benign
R7000:Mast1	UTSW	8	84928969	missense	probably damaging	1.00
R7011:Mast1	UTSW	8	84911945	nonsense	probably null
R7164:Mast1	UTSW	8	84935304	missense	possibly damaging	0.81
R7695:Mast1	UTSW	8	84920928	missense	probably damaging	1.00
R7845:Mast1	UTSW	8	84925325	nonsense	probably null
R7882:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R7965:Mast1	UTSW	8	84913318	critical splice donor site	probably null
X0066:Mast1	UTSW	8	84920878	missense	probably damaging	1.00
Z1176:Mast1	UTSW	8	84912459	missense	probably damaging	0.97
Z1176:Mast1	UTSW	8	84918681	missense	probably damaging	1.00
Z1177:Mast1	UTSW	8	84920446	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AAATCCGTGAGCTTGATGTGG -3'
(R):5'- CCCCTTCTGCAAAATGGGTAC -3'

Sequencing Primer
(F):5'- CTTGATGTGGCCCATGGAAG -3'
(R):5'- CCTTCTGCAAAATGGGTACAAGGG -3'

Posted On

2015-08-18