Mutagenetix > Incidental Mutations

Incidental Mutation 'R4533:Ttc3'

333218

Institutional Source

Beutler Lab

Gene Symbol

Ttc3

Ensembl Gene

ENSMUSG00000040785

Gene Name

tetratricopeptide repeat domain 3

Synonyms

2610202A04Rik, D16Ium21, D16Ium21e, TPRD

MMRRC Submission

041773-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.618) question?

Stock #

R4533 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94370618-94469343 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 94466877 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000156151 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000154196] [ENSMUST00000211314] [ENSMUST00000231569] [ENSMUST00000231915] [ENSMUST00000232395] [ENSMUST00000232660]

Predicted Effect

probably benign
Transcript: ENSMUST00000117648

SMART Domains

Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785

Domain	Start	End	E-Value	Type
TPR	231	264	3.61e-2	SMART
TPR	265	298	3.32e-1	SMART
Blast:TPR	300	332	2e-12	BLAST
low complexity region	444	459	N/A	INTRINSIC
TPR	576	609	2.55e-2	SMART
low complexity region	720	732	N/A	INTRINSIC
coiled coil region	765	796	N/A	INTRINSIC
low complexity region	1018	1032	N/A	INTRINSIC
low complexity region	1036	1050	N/A	INTRINSIC
low complexity region	1170	1190	N/A	INTRINSIC
low complexity region	1248	1260	N/A	INTRINSIC
low complexity region	1278	1291	N/A	INTRINSIC
coiled coil region	1472	1570	N/A	INTRINSIC
low complexity region	1876	1887	N/A	INTRINSIC
RING	1931	1970	7e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129536

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131429

Predicted Effect

probably benign
Transcript: ENSMUST00000154196

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211314

Predicted Effect

probably benign
Transcript: ENSMUST00000231569

Predicted Effect

probably benign
Transcript: ENSMUST00000231915

Predicted Effect

probably benign
Transcript: ENSMUST00000232368

Predicted Effect

probably benign
Transcript: ENSMUST00000232395

Predicted Effect

probably benign
Transcript: ENSMUST00000232660

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (54/54)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts7	A	G	9: 90,180,708	Y405C	probably damaging	Het
Ago3	A	T	4: 126,345,563	S832T	probably damaging	Het
Akap9	T	A	5: 4,043,948	F2157I	probably damaging	Het
Anapc5	T	C	5: 122,791,735	E561G	possibly damaging	Het
Art5	T	C	7: 102,098,338	H78R	probably benign	Het
Blvra	T	A	2: 127,090,384		probably null	Het
Ccdc171	A	G	4: 83,657,342	T488A	possibly damaging	Het
Crtc3	A	T	7: 80,589,795	M603K	probably damaging	Het
Csmd1	T	C	8: 15,931,037		probably null	Het
Dbh	C	A	2: 27,177,331	H409Q	possibly damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Gm12185	T	C	11: 48,907,920	Y582C	probably damaging	Het
Gm12185	T	C	11: 48,908,094	N524S	possibly damaging	Het
Gm7356	A	C	17: 14,001,410	I119R	probably damaging	Het
Heatr1	T	A	13: 12,434,511	D1963E	probably benign	Het
Ighv1-37	A	T	12: 114,896,527	V21D	probably damaging	Het
Itga3	T	G	11: 95,057,293	Q602P	probably benign	Het
Kcmf1	G	A	6: 72,849,591	R152C	probably damaging	Het
Lin54	T	C	5: 100,485,403	I141V	possibly damaging	Het
Mast1	T	A	8: 84,921,361	H497L	probably damaging	Het
Mrpl44	T	C	1: 79,776,254	F41S	possibly damaging	Het
Myo18b	T	C	5: 112,693,025	R2301G	probably damaging	Het
Nek1	A	T	8: 61,007,213	M58L	possibly damaging	Het
Olfr726	T	C	14: 50,083,699		probably null	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
P3h3	A	G	6: 124,854,408	V338A	possibly damaging	Het
Pcdha7	T	C	18: 36,975,407	V495A	possibly damaging	Het
Plcb3	T	C	19: 6,956,272	E895G	probably benign	Het
Plekha5	A	G	6: 140,570,331	E770G	probably damaging	Het
Ptchd3	C	T	11: 121,836,431	S377F	probably damaging	Het
Ptprj	C	T	2: 90,439,955	D1266N	probably damaging	Het
Raly	A	T	2: 154,865,933	E291V	probably damaging	Het
Rnf217	C	A	10: 31,608,763	C141F	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc12a3	A	G	8: 94,357,086	M914V	probably null	Het
Tbc1d9	A	G	8: 83,270,918	T1035A	probably damaging	Het
Tex14	C	T	11: 87,536,829	R36*	probably null	Het
Tiparp	A	G	3: 65,546,347	D172G	probably benign	Het
Uap1	A	T	1: 170,143,425	I466N	probably damaging	Het
Ubr1	T	C	2: 120,942,482	T426A	possibly damaging	Het
Vmn1r77	T	A	7: 12,041,829	H177Q	probably benign	Het
Vmn2r72	T	A	7: 85,751,926	H95L	probably benign	Het
Vwc2l	G	A	1: 70,882,139	C151Y	probably damaging	Het
Wdr12	T	C	1: 60,078,195	Y414C	probably benign	Het
Zfp609	A	C	9: 65,703,608	V691G	probably benign	Het
Zmiz1	T	C	14: 25,645,660	Y254H	probably damaging	Het

Other mutations in Ttc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Ttc3	APN	16	94426761	splice site	probably null
IGL00979:Ttc3	APN	16	94456718	missense	probably damaging	1.00
IGL01520:Ttc3	APN	16	94390207	missense	probably benign	0.04
IGL01663:Ttc3	APN	16	94409731	critical splice donor site	probably null
IGL01720:Ttc3	APN	16	94385369	missense	probably damaging	0.99
IGL01736:Ttc3	APN	16	94442527	missense	probably damaging	0.99
IGL02045:Ttc3	APN	16	94409681	splice site	probably benign
IGL02203:Ttc3	APN	16	94418598	splice site	probably benign
IGL02327:Ttc3	APN	16	94448108	missense	probably damaging	1.00
IGL02794:Ttc3	APN	16	94467926	missense	probably damaging	1.00
IGL02898:Ttc3	APN	16	94419426	missense	probably damaging	1.00
PIT4378001:Ttc3	UTSW	16	94410906	missense	probably benign	0.01
R0064:Ttc3	UTSW	16	94422247	missense	possibly damaging	0.79
R0098:Ttc3	UTSW	16	94390265	missense	probably benign	0.02
R0112:Ttc3	UTSW	16	94385322	splice site	probably benign
R0135:Ttc3	UTSW	16	94462268	missense	possibly damaging	0.92
R0480:Ttc3	UTSW	16	94432004	nonsense	probably null
R0513:Ttc3	UTSW	16	94426212	missense	probably damaging	1.00
R0532:Ttc3	UTSW	16	94387330	splice site	probably benign
R0607:Ttc3	UTSW	16	94456785	nonsense	probably null
R0742:Ttc3	UTSW	16	94459880	missense	probably benign	0.23
R0905:Ttc3	UTSW	16	94456789	nonsense	probably null
R1118:Ttc3	UTSW	16	94416268	splice site	probably benign
R1355:Ttc3	UTSW	16	94418637	missense	possibly damaging	0.46
R1370:Ttc3	UTSW	16	94418637	missense	possibly damaging	0.46
R1486:Ttc3	UTSW	16	94448129	missense	probably damaging	1.00
R1598:Ttc3	UTSW	16	94422297	missense	probably damaging	1.00
R1641:Ttc3	UTSW	16	94443317	missense	probably benign	0.19
R2092:Ttc3	UTSW	16	94442832	missense	probably benign	0.02
R2232:Ttc3	UTSW	16	94459972	missense	probably benign	0.00
R2339:Ttc3	UTSW	16	94431998	missense	probably damaging	1.00
R2342:Ttc3	UTSW	16	94431998	missense	probably damaging	1.00
R2842:Ttc3	UTSW	16	94431998	missense	probably damaging	1.00
R3117:Ttc3	UTSW	16	94442563	missense	possibly damaging	0.51
R4194:Ttc3	UTSW	16	94422277	missense	probably damaging	0.99
R4329:Ttc3	UTSW	16	94466961	missense	probably damaging	1.00
R4431:Ttc3	UTSW	16	94410958	critical splice donor site	probably null
R4530:Ttc3	UTSW	16	94466877	intron	probably benign
R4531:Ttc3	UTSW	16	94466877	intron	probably benign
R4532:Ttc3	UTSW	16	94466877	intron	probably benign
R4588:Ttc3	UTSW	16	94442901	missense	probably benign	0.01
R4625:Ttc3	UTSW	16	94388272	nonsense	probably null
R4676:Ttc3	UTSW	16	94442761	missense	probably damaging	1.00
R4700:Ttc3	UTSW	16	94439241	splice site	probably null
R4856:Ttc3	UTSW	16	94390283	missense	probably benign	0.32
R4867:Ttc3	UTSW	16	94454515	missense	probably damaging	0.96
R4885:Ttc3	UTSW	16	94419465	missense	probably damaging	1.00
R4885:Ttc3	UTSW	16	94426831	critical splice donor site	probably null
R4899:Ttc3	UTSW	16	94429455	missense	probably damaging	1.00
R4997:Ttc3	UTSW	16	94452982	missense	probably damaging	1.00
R5023:Ttc3	UTSW	16	94429359	missense	probably benign	0.01
R5105:Ttc3	UTSW	16	94466934	missense	possibly damaging	0.94
R5205:Ttc3	UTSW	16	94448059	missense	probably benign	0.07
R5287:Ttc3	UTSW	16	94459844	missense	probably benign	0.00
R5338:Ttc3	UTSW	16	94384041	missense	probably damaging	0.99
R5347:Ttc3	UTSW	16	94429620	missense	probably damaging	1.00
R5403:Ttc3	UTSW	16	94459844	missense	probably benign	0.00
R5460:Ttc3	UTSW	16	94457382	missense	probably benign	0.32
R5739:Ttc3	UTSW	16	94439324	nonsense	probably null
R6242:Ttc3	UTSW	16	94442695	missense	probably benign	0.04
R6253:Ttc3	UTSW	16	94457413	critical splice donor site	probably null
R6455:Ttc3	UTSW	16	94418623	start codon destroyed	probably null	0.83
R6559:Ttc3	UTSW	16	94422349	critical splice donor site	probably null
R6564:Ttc3	UTSW	16	94442611	missense	probably damaging	1.00
R6932:Ttc3	UTSW	16	94443453	missense	probably benign
R7331:Ttc3	UTSW	16	94394359	missense	probably benign	0.27
R7497:Ttc3	UTSW	16	94418682	missense	possibly damaging	0.93
R7610:Ttc3	UTSW	16	94427838	missense	probably benign	0.11
R7738:Ttc3	UTSW	16	94387382	missense	probably benign	0.00
R7970:Ttc3	UTSW	16	94457364	missense	probably damaging	1.00
R8052:Ttc3	UTSW	16	94467989	missense	probably benign	0.09
R8087:Ttc3	UTSW	16	94442953	missense	probably benign	0.00
R8309:Ttc3	UTSW	16	94466979	missense	probably damaging	1.00
R8320:Ttc3	UTSW	16	94418676	missense	probably damaging	1.00
R8322:Ttc3	UTSW	16	94454492	missense	probably damaging	1.00
R8518:Ttc3	UTSW	16	94457379	missense	probably benign	0.21
R8670:Ttc3	UTSW	16	94390208	missense	probably damaging	0.99
X0022:Ttc3	UTSW	16	94442525	missense	probably benign	0.00
Y5378:Ttc3	UTSW	16	94412129	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- CTGTTGAAACGGTTCCCTCTG -3'
(R):5'- TGTTTACAGTCACATGAACACATG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CCACATTTTAGCACACGC -3'

Posted On

2015-08-18