Incidental Mutation 'R4534:Lhx3'
ID333226
Institutional Source Beutler Lab
Gene Symbol Lhx3
Ensembl Gene ENSMUSG00000026934
Gene NameLIM homeobox protein 3
SynonymsmLim-3, Lim3, P-LIM
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4534 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26200212-26208289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26204014 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 66 (V66I)
Ref Sequence ENSEMBL: ENSMUSP00000056822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028302] [ENSMUST00000054099] [ENSMUST00000091263]
PDB Structure
NMR Solution Structure of a ldb1-LID:Lhx3-LIM complex [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000028302
AA Change: V68I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028302
Gene: ENSMUSG00000026934
AA Change: V68I

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
LIM 35 86 4.18e-17 SMART
LIM 94 149 7.8e-17 SMART
HOX 162 224 7.13e-23 SMART
low complexity region 237 249 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 353 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054099
AA Change: V66I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056822
Gene: ENSMUSG00000026934
AA Change: V66I

DomainStartEndE-ValueType
LIM 33 84 4.18e-17 SMART
LIM 92 147 7.8e-17 SMART
HOX 160 222 7.13e-23 SMART
low complexity region 235 247 N/A INTRINSIC
low complexity region 321 340 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091263
SMART Domains Protein: ENSMUSP00000088807
Gene: ENSMUSG00000036327

DomainStartEndE-ValueType
low complexity region 130 145 N/A INTRINSIC
Blast:HOX 190 233 1e-13 BLAST
Pfam:Evr1_Alr 259 361 2.4e-30 PFAM
transmembrane domain 490 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127035
SMART Domains Protein: ENSMUSP00000134884
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
Pfam:Homeobox 1 17 6.2e-5 PFAM
low complexity region 35 47 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149637
SMART Domains Protein: ENSMUSP00000135765
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184787
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor that is required for pituitary development and motor neuron specification. Mutations in this gene cause combined pituitary hormone deficiency 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failure of growth and differentiation of Rathke's pouch, lack both anterior and intermediate lobes of the pituitary gland, and die perinatally, within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,037,995 T454I possibly damaging Het
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Clstn3 C T 6: 124,459,220 R190Q probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnaaf5 C T 5: 139,151,527 Q212* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Eri2 T C 7: 119,790,243 T151A probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gm10320 G A 13: 98,489,808 P23S probably benign Het
Gm10696 T C 3: 94,176,450 Y18C probably benign Het
Hbs1l A G 10: 21,341,915 I240M possibly damaging Het
Heatr5b T C 17: 78,810,596 H806R possibly damaging Het
Herc3 T C 6: 58,860,347 V335A probably benign Het
Ifi205 G A 1: 174,017,641 P192S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna9 T C 4: 88,592,048 H113R possibly damaging Het
Il17rd T C 14: 27,096,062 F236S probably damaging Het
Incenp T C 19: 9,883,939 N450S unknown Het
Jmjd8 C T 17: 25,829,010 probably null Het
Nt5c2 C T 19: 46,891,661 C336Y probably damaging Het
Ntrk2 G A 13: 59,126,529 V740I probably damaging Het
Ocln A T 13: 100,511,604 I104N possibly damaging Het
Olfr761 T C 17: 37,952,722 I101V probably benign Het
Olfr969 G T 9: 39,796,000 L208F probably benign Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sh3glb1 T A 3: 144,699,863 E77D possibly damaging Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Stox2 A T 8: 47,193,379 S287T probably damaging Het
Sycp2 C A 2: 178,355,009 V1134F probably damaging Het
Tenm2 C T 11: 36,063,104 S1260N possibly damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Thoc5 C T 11: 4,924,807 R533* probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Uchl5 C T 1: 143,786,216 T76I probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Xpa T C 4: 46,185,624 N118S probably benign Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Xylt2 T C 11: 94,666,350 D105G probably benign Het
Other mutations in Lhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Lhx3 APN 2 26201373 missense probably benign
IGL02691:Lhx3 APN 2 26203085 missense probably damaging 1.00
R0267:Lhx3 UTSW 2 26203028 missense probably benign 0.02
R0571:Lhx3 UTSW 2 26201124 missense probably damaging 1.00
R0574:Lhx3 UTSW 2 26201311 missense probably benign 0.00
R1866:Lhx3 UTSW 2 26203974 missense probably damaging 0.99
R1926:Lhx3 UTSW 2 26202188 nonsense probably null
R1940:Lhx3 UTSW 2 26203962 missense probably benign 0.05
R3147:Lhx3 UTSW 2 26201265 missense probably benign 0.01
R4389:Lhx3 UTSW 2 26201090 utr 3 prime probably benign
R4551:Lhx3 UTSW 2 26201190 missense probably damaging 1.00
R4761:Lhx3 UTSW 2 26201423 frame shift probably null
R5102:Lhx3 UTSW 2 26201423 frame shift probably null
R5105:Lhx3 UTSW 2 26201423 frame shift probably null
R5431:Lhx3 UTSW 2 26201118 missense probably damaging 1.00
R5673:Lhx3 UTSW 2 26202994 missense probably damaging 1.00
R5751:Lhx3 UTSW 2 26201161 missense probably benign
R6180:Lhx3 UTSW 2 26201491 missense probably benign
R6262:Lhx3 UTSW 2 26202423 small deletion probably benign
R7238:Lhx3 UTSW 2 26202997 missense probably damaging 1.00
Z1176:Lhx3 UTSW 2 26203987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTCAGGGTGCCCTATTTGG -3'
(R):5'- ATCCTTGCACACCCCTAAGG -3'

Sequencing Primer
(F):5'- CCTATTTGGGTAGGGACCTAGG -3'
(R):5'- ACCCCTAAGGCCTGCAG -3'
Posted On2015-08-18