Incidental Mutation 'R0107:Zfp235'
Institutional Source Beutler Lab
Gene Symbol Zfp235
Ensembl Gene ENSMUSG00000047603
Gene Namezinc finger protein 235
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0107 (G1)
Quality Score206
Status Validated (trace)
Chromosomal Location24134169-24143241 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24137116 bp
Amino Acid Change Glutamine to Arginine at position 29 (Q29R)
Ref Sequence ENSEMBL: ENSMUSP00000050803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056549] [ENSMUST00000205680]
Predicted Effect probably damaging
Transcript: ENSMUST00000056549
AA Change: Q29R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050803
Gene: ENSMUSG00000047603
AA Change: Q29R

KRAB 8 71 1.09e-15 SMART
ZnF_C2H2 283 305 1.79e-2 SMART
ZnF_C2H2 311 333 3.16e-3 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 6.99e-5 SMART
ZnF_C2H2 395 417 1.33e-1 SMART
ZnF_C2H2 423 445 3.16e-3 SMART
ZnF_C2H2 451 473 2.84e-5 SMART
ZnF_C2H2 479 501 6.32e-3 SMART
ZnF_C2H2 507 529 3.44e-4 SMART
ZnF_C2H2 535 557 2.12e-4 SMART
ZnF_C2H2 563 585 1.38e-3 SMART
ZnF_C2H2 591 613 2.27e-4 SMART
ZnF_C2H2 619 641 5.99e-4 SMART
ZnF_C2H2 647 669 5.9e-3 SMART
ZnF_C2H2 675 697 4.87e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205680
AA Change: Q29R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206809
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the zinc finger protein superfamily, members of which are regulatory proteins characterized by nucleic acid-binding zinc finger domains. The encoded protein is a member of the Kruppel family of zinc finger proteins, and contains Kruppel-associated box (KRAB) A and B domains and 15 tandemly arrayed C2H2-type zinc fingers. It is an ortholog of the mouse Zfp93 protein. This gene is located in a cluster of zinc finger genes on 19q13.2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Zfp235
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Zfp235 APN 7 24137080 missense probably damaging 1.00
IGL02326:Zfp235 APN 7 24135302 start codon destroyed probably null 0.98
R0271:Zfp235 UTSW 7 24137131 missense possibly damaging 0.93
R0513:Zfp235 UTSW 7 24142219 missense probably damaging 1.00
R1004:Zfp235 UTSW 7 24140744 missense probably damaging 1.00
R1928:Zfp235 UTSW 7 24141138 nonsense probably null
R1958:Zfp235 UTSW 7 24140346 missense probably damaging 0.98
R2167:Zfp235 UTSW 7 24140962 missense possibly damaging 0.80
R2511:Zfp235 UTSW 7 24142124 missense probably damaging 1.00
R3013:Zfp235 UTSW 7 24140732 missense probably damaging 0.98
R3806:Zfp235 UTSW 7 24140621 missense probably benign 0.01
R4613:Zfp235 UTSW 7 24141676 missense probably damaging 1.00
R4876:Zfp235 UTSW 7 24140959 missense probably benign 0.01
R4977:Zfp235 UTSW 7 24142184 missense possibly damaging 0.94
R5085:Zfp235 UTSW 7 24137121 missense probably damaging 0.96
R5664:Zfp235 UTSW 7 24142151 missense probably damaging 1.00
R6440:Zfp235 UTSW 7 24140615 missense probably damaging 0.96
R6650:Zfp235 UTSW 7 24137038 splice site probably null
R7694:Zfp235 UTSW 7 24142100 missense probably benign 0.37
R8031:Zfp235 UTSW 7 24141689 missense probably benign 0.19
R8188:Zfp235 UTSW 7 24141871 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cctaataaacccttttcttcccaac -3'
(R):5'- gcacagacacacacgcag -3'
Posted On2013-05-09