Incidental Mutation 'R4534:Ifna9'
ID333230
Institutional Source Beutler Lab
Gene Symbol Ifna9
Ensembl Gene ENSMUSG00000095270
Gene Nameinterferon alpha 9
SynonymsIfa9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4534 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location88591813-88592385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88592048 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 113 (H113R)
Ref Sequence ENSEMBL: ENSMUSP00000099871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102807]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102807
AA Change: H113R

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099871
Gene: ENSMUSG00000095270
AA Change: H113R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IFabd 58 175 1.68e-67 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,037,995 T454I possibly damaging Het
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Clstn3 C T 6: 124,459,220 R190Q probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnaaf5 C T 5: 139,151,527 Q212* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Eri2 T C 7: 119,790,243 T151A probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gm10320 G A 13: 98,489,808 P23S probably benign Het
Gm10696 T C 3: 94,176,450 Y18C probably benign Het
Hbs1l A G 10: 21,341,915 I240M possibly damaging Het
Heatr5b T C 17: 78,810,596 H806R possibly damaging Het
Herc3 T C 6: 58,860,347 V335A probably benign Het
Ifi205 G A 1: 174,017,641 P192S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Il17rd T C 14: 27,096,062 F236S probably damaging Het
Incenp T C 19: 9,883,939 N450S unknown Het
Jmjd8 C T 17: 25,829,010 probably null Het
Lhx3 C T 2: 26,204,014 V66I probably benign Het
Nt5c2 C T 19: 46,891,661 C336Y probably damaging Het
Ntrk2 G A 13: 59,126,529 V740I probably damaging Het
Ocln A T 13: 100,511,604 I104N possibly damaging Het
Olfr761 T C 17: 37,952,722 I101V probably benign Het
Olfr969 G T 9: 39,796,000 L208F probably benign Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sh3glb1 T A 3: 144,699,863 E77D possibly damaging Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Stox2 A T 8: 47,193,379 S287T probably damaging Het
Sycp2 C A 2: 178,355,009 V1134F probably damaging Het
Tenm2 C T 11: 36,063,104 S1260N possibly damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Thoc5 C T 11: 4,924,807 R533* probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Uchl5 C T 1: 143,786,216 T76I probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Xpa T C 4: 46,185,624 N118S probably benign Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Xylt2 T C 11: 94,666,350 D105G probably benign Het
Other mutations in Ifna9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01788:Ifna9 APN 4 88591860 missense probably damaging 1.00
IGL02268:Ifna9 APN 4 88592354 nonsense probably null
R0579:Ifna9 UTSW 4 88592271 missense possibly damaging 0.84
R1530:Ifna9 UTSW 4 88592172 missense possibly damaging 0.83
R1663:Ifna9 UTSW 4 88591983 missense probably benign 0.00
R1872:Ifna9 UTSW 4 88592255 missense probably damaging 0.97
R3923:Ifna9 UTSW 4 88592271 missense possibly damaging 0.84
R4882:Ifna9 UTSW 4 88592303 missense probably benign 0.01
R5440:Ifna9 UTSW 4 88591811 splice site probably null
R6008:Ifna9 UTSW 4 88592363 missense probably null 1.00
R6464:Ifna9 UTSW 4 88592250 missense possibly damaging 0.93
R6584:Ifna9 UTSW 4 88592138 missense probably damaging 0.99
R6899:Ifna9 UTSW 4 88592063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTTCTGCTCTGACCAC -3'
(R):5'- ACACTCCTGGCACAAATGAG -3'

Sequencing Primer
(F):5'- TCTGACCACCTCCCAGGC -3'
(R):5'- CTCTCTTGCCTGAAGGACAG -3'
Posted On2015-08-18