Incidental Mutation 'R0107:Fut1'
ID33324
Institutional Source Beutler Lab
Gene Symbol Fut1
Ensembl Gene ENSMUSG00000008461
Gene Namefucosyltransferase 1
SynonymsH transferase
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0107 (G1)
Quality Score222
Status Validated (trace)
Chromosome7
Chromosomal Location45617289-45621059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45618846 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 20 (Q20K)
Ref Sequence ENSEMBL: ENSMUSP00000147274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008605] [ENSMUST00000033099] [ENSMUST00000033100] [ENSMUST00000209379] [ENSMUST00000210150]
Predicted Effect probably benign
Transcript: ENSMUST00000008605
AA Change: Q75K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000008605
Gene: ENSMUSG00000008461
AA Change: Q75K

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Glyco_transf_11 39 355 3.1e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033099
SMART Domains Protein: ENSMUSP00000033099
Gene: ENSMUSG00000030827

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FGF 44 169 3.95e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033100
SMART Domains Protein: ENSMUSP00000033100
Gene: ENSMUSG00000064158

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
Pfam:IZUMO 21 166 2.6e-53 PFAM
IG 167 253 2.43e-2 SMART
transmembrane domain 320 342 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209379
AA Change: Q20K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000210150
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous null mice are viable and healthy, lack alpha(1,2)fucose residues from the apical surface of pancreatic acinar glands and are deficient in epididymal cell surface alpha(1,2)fucosylated glycans but show normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Fut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Fut1 APN 7 45619431 missense probably damaging 1.00
IGL02015:Fut1 APN 7 45618975 missense probably damaging 0.98
IGL02232:Fut1 APN 7 45619447 missense probably damaging 1.00
IGL02934:Fut1 APN 7 45618703 missense possibly damaging 0.49
IGL02976:Fut1 APN 7 45619320 missense probably damaging 1.00
IGL03091:Fut1 APN 7 45619527 missense probably damaging 1.00
IGL03169:Fut1 APN 7 45619033 missense probably benign 0.05
R0107:Fut1 UTSW 7 45618846 missense possibly damaging 0.50
R1413:Fut1 UTSW 7 45619428 missense probably damaging 0.98
R2039:Fut1 UTSW 7 45618991 missense possibly damaging 0.62
R2403:Fut1 UTSW 7 45619219 missense probably benign 0.14
R2516:Fut1 UTSW 7 45619198 missense probably benign 0.03
R3429:Fut1 UTSW 7 45619374 missense probably damaging 1.00
R3430:Fut1 UTSW 7 45619374 missense probably damaging 1.00
R5775:Fut1 UTSW 7 45619462 missense probably damaging 1.00
R6244:Fut1 UTSW 7 45619306 missense possibly damaging 0.79
R6961:Fut1 UTSW 7 45619539 missense probably damaging 0.99
R7052:Fut1 UTSW 7 45619757 makesense probably null
R8027:Fut1 UTSW 7 45618865 missense probably damaging 1.00
Z1177:Fut1 UTSW 7 45619229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCAGACTCGGTGGCTTAATCTGTG -3'
(R):5'- AGGACTAAGTGCTGCCAAGGTGTG -3'

Sequencing Primer
(F):5'- TAGCTATGTGGACTCCCAGC -3'
(R):5'- AAGGTGTGAGGCTGTCCAC -3'
Posted On2013-05-09