Incidental Mutation 'R4534:Olfr761'
ID333264
Institutional Source Beutler Lab
Gene Symbol Olfr761
Ensembl Gene ENSMUSG00000109376
Gene Nameolfactory receptor 761
SynonymsMOR218-5P, MOR218-6P, MOR218-12, Olfr1552-ps1, GA_x6K02T2PSCP-2403971-2403000, MOR218-6P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R4534 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37952051-37953079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37952722 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 101 (I101V)
Ref Sequence ENSEMBL: ENSMUSP00000092917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049620]
Predicted Effect probably benign
Transcript: ENSMUST00000049620
AA Change: I101V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092917
Gene: ENSMUSG00000109376
AA Change: I101V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 3.7e-22 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,037,995 T454I possibly damaging Het
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Clstn3 C T 6: 124,459,220 R190Q probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnaaf5 C T 5: 139,151,527 Q212* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Eri2 T C 7: 119,790,243 T151A probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gm10320 G A 13: 98,489,808 P23S probably benign Het
Gm10696 T C 3: 94,176,450 Y18C probably benign Het
Hbs1l A G 10: 21,341,915 I240M possibly damaging Het
Heatr5b T C 17: 78,810,596 H806R possibly damaging Het
Herc3 T C 6: 58,860,347 V335A probably benign Het
Ifi205 G A 1: 174,017,641 P192S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna9 T C 4: 88,592,048 H113R possibly damaging Het
Il17rd T C 14: 27,096,062 F236S probably damaging Het
Incenp T C 19: 9,883,939 N450S unknown Het
Jmjd8 C T 17: 25,829,010 probably null Het
Lhx3 C T 2: 26,204,014 V66I probably benign Het
Nt5c2 C T 19: 46,891,661 C336Y probably damaging Het
Ntrk2 G A 13: 59,126,529 V740I probably damaging Het
Ocln A T 13: 100,511,604 I104N possibly damaging Het
Olfr969 G T 9: 39,796,000 L208F probably benign Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sh3glb1 T A 3: 144,699,863 E77D possibly damaging Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Stox2 A T 8: 47,193,379 S287T probably damaging Het
Sycp2 C A 2: 178,355,009 V1134F probably damaging Het
Tenm2 C T 11: 36,063,104 S1260N possibly damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Thoc5 C T 11: 4,924,807 R533* probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Uchl5 C T 1: 143,786,216 T76I probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Xpa T C 4: 46,185,624 N118S probably benign Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Xylt2 T C 11: 94,666,350 D105G probably benign Het
Other mutations in Olfr761
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Olfr761 APN 17 37952851 missense probably damaging 1.00
IGL02104:Olfr761 APN 17 37952291 missense probably damaging 1.00
IGL02431:Olfr761 APN 17 37952522 missense probably benign 0.06
IGL02649:Olfr761 APN 17 37952973 missense probably damaging 1.00
IGL03109:Olfr761 APN 17 37952487 missense probably damaging 1.00
IGL03261:Olfr761 APN 17 37952806 missense possibly damaging 0.76
R0898:Olfr761 UTSW 17 37952236 missense probably benign 0.17
R1373:Olfr761 UTSW 17 37952360 missense probably damaging 1.00
R1527:Olfr761 UTSW 17 37952829 missense possibly damaging 0.88
R1664:Olfr761 UTSW 17 37952893 missense probably benign 0.44
R1835:Olfr761 UTSW 17 37952385 missense possibly damaging 0.79
R4124:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4125:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4128:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4557:Olfr761 UTSW 17 37952251 missense probably benign 0.10
R4790:Olfr761 UTSW 17 37952742 missense probably damaging 0.99
R4856:Olfr761 UTSW 17 37952071 missense probably benign 0.15
R4886:Olfr761 UTSW 17 37952071 missense probably benign 0.15
R4955:Olfr761 UTSW 17 37952898 missense probably damaging 1.00
R5162:Olfr761 UTSW 17 37952364 missense probably benign 0.00
R6016:Olfr761 UTSW 17 37952076 missense probably benign 0.13
R6282:Olfr761 UTSW 17 37952424 missense possibly damaging 0.80
R7018:Olfr761 UTSW 17 37952502 missense probably damaging 1.00
R7199:Olfr761 UTSW 17 37952157 missense probably damaging 1.00
R7340:Olfr761 UTSW 17 37952522 missense probably benign 0.06
R7360:Olfr761 UTSW 17 37953009 missense probably damaging 1.00
R7464:Olfr761 UTSW 17 37952280 missense probably damaging 1.00
X0064:Olfr761 UTSW 17 37952814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGAATCTGATAGAGAGTGTACTTG -3'
(R):5'- TATTGGGCTCAGCAGGGAAC -3'

Sequencing Primer
(F):5'- GCTGTGAATAATGTTCCTGAGATACC -3'
(R):5'- CAGCAGGGAACTTCATTATTATCACC -3'
Posted On2015-08-18