Incidental Mutation 'R4534:Heatr5b'
ID 333265
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene Name HEAT repeat containing 5B
Synonyms 2010013B10Rik, A230048G03Rik, D330050P16Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock # R4534 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 78752906-78835381 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78810596 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 806 (H806R)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
AlphaFold Q8C547
Predicted Effect possibly damaging
Transcript: ENSMUST00000097281
AA Change: H806R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: H806R

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,037,995 T454I possibly damaging Het
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Clstn3 C T 6: 124,459,220 R190Q probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnaaf5 C T 5: 139,151,527 Q212* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Eri2 T C 7: 119,790,243 T151A probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gm10320 G A 13: 98,489,808 P23S probably benign Het
Gm10696 T C 3: 94,176,450 Y18C probably benign Het
Hbs1l A G 10: 21,341,915 I240M possibly damaging Het
Herc3 T C 6: 58,860,347 V335A probably benign Het
Ifi205 G A 1: 174,017,641 P192S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna9 T C 4: 88,592,048 H113R possibly damaging Het
Il17rd T C 14: 27,096,062 F236S probably damaging Het
Incenp T C 19: 9,883,939 N450S unknown Het
Jmjd8 C T 17: 25,829,010 probably null Het
Lhx3 C T 2: 26,204,014 V66I probably benign Het
Nt5c2 C T 19: 46,891,661 C336Y probably damaging Het
Ntrk2 G A 13: 59,126,529 V740I probably damaging Het
Ocln A T 13: 100,511,604 I104N possibly damaging Het
Olfr761 T C 17: 37,952,722 I101V probably benign Het
Olfr969 G T 9: 39,796,000 L208F probably benign Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sh3glb1 T A 3: 144,699,863 E77D possibly damaging Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Stox2 A T 8: 47,193,379 S287T probably damaging Het
Sycp2 C A 2: 178,355,009 V1134F probably damaging Het
Tenm2 C T 11: 36,063,104 S1260N possibly damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Thoc5 C T 11: 4,924,807 R533* probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Uchl5 C T 1: 143,786,216 T76I probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Xpa T C 4: 46,185,624 N118S probably benign Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Xylt2 T C 11: 94,666,350 D105G probably benign Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R5470_heatr5b_501 UTSW 17 78821579 splice site probably null
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
R7922:Heatr5b UTSW 17 78760559 missense probably benign 0.01
R8184:Heatr5b UTSW 17 78814233 missense probably benign 0.03
R8222:Heatr5b UTSW 17 78801701 missense possibly damaging 0.95
R8276:Heatr5b UTSW 17 78791539 nonsense probably null
R8324:Heatr5b UTSW 17 78755364 missense possibly damaging 0.85
R8430:Heatr5b UTSW 17 78829624 missense probably damaging 0.97
R8432:Heatr5b UTSW 17 78803501 missense probably damaging 0.99
R8672:Heatr5b UTSW 17 78762203 missense probably damaging 1.00
R8781:Heatr5b UTSW 17 78795309 missense probably benign 0.19
R8794:Heatr5b UTSW 17 78815586 missense probably benign 0.00
R8808:Heatr5b UTSW 17 78765405 missense possibly damaging 0.92
R8850:Heatr5b UTSW 17 78801759 missense probably benign 0.02
R8893:Heatr5b UTSW 17 78761995 splice site probably benign
R9010:Heatr5b UTSW 17 78773710 missense probably damaging 1.00
R9041:Heatr5b UTSW 17 78796432 missense probably benign 0.12
R9150:Heatr5b UTSW 17 78796019 missense probably benign
R9253:Heatr5b UTSW 17 78827994 missense probably benign 0.13
R9318:Heatr5b UTSW 17 78765402 missense probably benign 0.07
R9448:Heatr5b UTSW 17 78760586 missense probably benign 0.26
R9489:Heatr5b UTSW 17 78753250 nonsense probably null
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CCAAAGCAAGCAGGGTTGAC -3'
(R):5'- ACAGTCCAGGGGCATAATTG -3'

Sequencing Primer
(F):5'- GGAAGGCTTACAACCATCTGTACAG -3'
(R):5'- TTTAATCCCAGCACTTAGGAGGCAG -3'
Posted On 2015-08-18