Mutagenetix > Incidental Mutations

Incidental Mutation 'R0107:Irs2'

33327

Institutional Source

Beutler Lab

Gene Symbol

Irs2

Ensembl Gene

ENSMUSG00000038894

Gene Name

insulin receptor substrate 2

Synonyms

Irs-2

MMRRC Submission

038393-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.511) question?

Stock #

R0107 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

10984681-11008458 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11004691 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1247 (V1247E)

Ref Sequence

ENSEMBL: ENSMUSP00000038514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040514]

PDB Structure

Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040514
AA Change: V1247E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: V1247E

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	19	28	N/A	INTRINSIC
PH	31	146	2.83e-13	SMART
IRS	191	293	4.98e-38	SMART
PTBI	191	293	2.24e-51	SMART
low complexity region	301	309	N/A	INTRINSIC
low complexity region	364	377	N/A	INTRINSIC
low complexity region	435	473	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	688	710	N/A	INTRINSIC
low complexity region	721	730	N/A	INTRINSIC
low complexity region	834	846	N/A	INTRINSIC
low complexity region	923	959	N/A	INTRINSIC
low complexity region	976	984	N/A	INTRINSIC
low complexity region	997	1028	N/A	INTRINSIC
low complexity region	1137	1154	N/A	INTRINSIC
low complexity region	1191	1208	N/A	INTRINSIC
low complexity region	1274	1296	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180750

Meta Mutation Damage Score

0.1289

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.6%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,080,834	V825A	probably benign	Het
Adamts7	T	C	9: 90,180,720	I409T	possibly damaging	Het
Adck1	T	C	12: 88,446,656	W253R	possibly damaging	Het
Afg3l2	A	G	18: 67,431,766	F213L	probably damaging	Het
Ankle2	T	C	5: 110,253,027	V743A	probably benign	Het
Ankrd34c	C	T	9: 89,729,484	R268H	probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc7b	T	G	8: 129,178,197		probably benign	Het
Cd320	A	T	17: 33,848,085	M169L	probably benign	Het
Chn1	A	G	2: 73,614,684	Y338H	probably damaging	Het
Chuk	T	A	19: 44,096,919	S263C	probably damaging	Het
Dennd4b	C	A	3: 90,272,736	P663T	possibly damaging	Het
Dnajc24	T	G	2: 106,001,914		probably benign	Het
Fam172a	A	G	13: 77,902,814	D145G	probably damaging	Het
Fbn2	A	G	18: 58,056,203	V1617A	probably benign	Het
Fermt2	T	C	14: 45,464,822	N502D	probably damaging	Het
Frrs1	A	T	3: 116,896,716	I3F	probably damaging	Het
Fut1	C	A	7: 45,618,846	Q20K	possibly damaging	Het
Gbf1	T	C	19: 46,284,828	V1709A	probably benign	Het
Gfra3	G	T	18: 34,711,306	H60Q	probably benign	Het
Gm10750	T	A	2: 149,016,053	M93L	unknown	Het
Gm5538	T	A	3: 59,752,316	L397I	possibly damaging	Het
Hmcn1	T	A	1: 150,587,015	I5124L	probably benign	Het
Hps3	A	C	3: 20,030,796	L76R	probably damaging	Het
Ifrd1	T	A	12: 40,214,081	Q105L	probably damaging	Het
Itgal	T	C	7: 127,328,559		probably benign	Het
Ivns1abp	A	T	1: 151,361,570	N495I	probably damaging	Het
Kank1	T	A	19: 25,430,366		probably benign	Het
Mroh8	T	C	2: 157,225,468	Q657R	probably benign	Het
Mthfd1l	T	C	10: 4,041,838	Y597H	probably benign	Het
Myom1	G	A	17: 71,077,365	V692I	probably damaging	Het
Olfr347	T	G	2: 36,734,718	Y132*	probably null	Het
Olfr45	A	T	7: 140,691,345	M147L	probably benign	Het
Olfr835	A	G	9: 19,035,333	D70G	probably damaging	Het
Palmd	A	T	3: 116,924,076	H257Q	probably damaging	Het
Pcnx2	A	T	8: 125,753,586	V1994D	probably benign	Het
Phkb	G	A	8: 86,016,931	G553S	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Ptprn	A	T	1: 75,255,712	L453M	probably damaging	Het
Ptprz1	T	A	6: 23,000,570	D886E	probably damaging	Het
Rcn1	T	A	2: 105,394,781	I110F	possibly damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Slc6a19	A	G	13: 73,684,057	Y467H	possibly damaging	Het
Slc9c1	T	A	16: 45,575,420	D611E	probably benign	Het
Slitrk6	T	C	14: 110,751,963	E104G	possibly damaging	Het
Spag17	A	T	3: 100,050,787	K920N	possibly damaging	Het
St3gal5	A	G	6: 72,142,149	S82G	probably benign	Het
Tlk1	T	C	2: 70,713,989	*767W	probably null	Het
Tln2	A	G	9: 67,370,706	V342A	probably damaging	Het
Tmem104	T	A	11: 115,202,180	M132K	probably damaging	Het
Tmem184c	A	G	8: 77,597,073	S387P	possibly damaging	Het
Tmtc1	A	G	6: 148,425,913	V34A	possibly damaging	Het
Trim46	A	G	3: 89,236,333	F596S	probably damaging	Het
Unc79	T	A	12: 103,134,525	D1870E	possibly damaging	Het
Utp20	T	C	10: 88,778,391	T1234A	probably benign	Het
Vmn1r31	T	A	6: 58,472,743	T46S	probably benign	Het
Vps13a	A	T	19: 16,691,824	L1341Q	probably benign	Het
Wdr72	A	T	9: 74,210,433	D821V	probably damaging	Het
Zfhx4	T	C	3: 5,398,982	L1400P	probably damaging	Het
Zfp217	T	A	2: 170,114,874	K735*	probably null	Het
Zfp235	A	G	7: 24,137,116	Q29R	probably damaging	Het
Zfp628	A	G	7: 4,920,168	Y463C	probably damaging	Het
Zkscan4	A	G	13: 21,484,581	T401A	possibly damaging	Het

Other mutations in Irs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Irs2	APN	8	11005867	missense	probably benign	0.00
IGL01328:Irs2	APN	8	11004792	missense	probably damaging	0.99
IGL01875:Irs2	APN	8	11006221	missense	probably damaging	0.98
IGL02444:Irs2	APN	8	11006306	missense	probably benign	0.03
IGL02448:Irs2	APN	8	11007862	missense	probably benign	0.21
IGL02945:Irs2	APN	8	11007781	missense	probably damaging	1.00
IGL03068:Irs2	APN	8	11004974	missense	probably damaging	0.99
beefed	UTSW	8	11006522	nonsense	probably null
Dum_dum	UTSW	8	10987012	makesense	probably null
Lush	UTSW	8	11006678	nonsense	probably null
muscular	UTSW	8	11004659	nonsense	probably null
R0062:Irs2	UTSW	8	11005723	missense	possibly damaging	0.65
R0062:Irs2	UTSW	8	11005723	missense	possibly damaging	0.65
R0147:Irs2	UTSW	8	11007568	missense	probably damaging	1.00
R0501:Irs2	UTSW	8	11006396	missense	probably damaging	1.00
R0565:Irs2	UTSW	8	11004592	missense	probably damaging	0.98
R2042:Irs2	UTSW	8	11007580	missense	probably damaging	0.99
R2268:Irs2	UTSW	8	11007586	missense	probably damaging	0.98
R2518:Irs2	UTSW	8	11005352	missense	probably benign	0.00
R2762:Irs2	UTSW	8	11006408	missense	probably damaging	1.00
R3623:Irs2	UTSW	8	11007643	missense	probably damaging	1.00
R3624:Irs2	UTSW	8	11007643	missense	probably damaging	1.00
R5022:Irs2	UTSW	8	10987012	makesense	probably null
R5270:Irs2	UTSW	8	11006678	nonsense	probably null
R5377:Irs2	UTSW	8	11005277	missense	probably benign	0.00
R5604:Irs2	UTSW	8	11005007	missense	possibly damaging	0.84
R6049:Irs2	UTSW	8	11006805	missense	probably benign	0.01
R6219:Irs2	UTSW	8	11005121	missense	probably damaging	0.99
R6654:Irs2	UTSW	8	11006486	missense	probably damaging	1.00
R6726:Irs2	UTSW	8	11004961	missense	possibly damaging	0.86
R6813:Irs2	UTSW	8	11004659	nonsense	probably null
R6934:Irs2	UTSW	8	11004697	missense	probably damaging	0.99
R7261:Irs2	UTSW	8	11007018	missense	possibly damaging	0.95
R7285:Irs2	UTSW	8	11006797	missense	probably damaging	0.99
R7458:Irs2	UTSW	8	11007739	missense	probably damaging	0.99
R7757:Irs2	UTSW	8	11006522	nonsense	probably null
R8347:Irs2	UTSW	8	11008000	missense	possibly damaging	0.82
R8377:Irs2	UTSW	8	11004848	nonsense	probably null
R8444:Irs2	UTSW	8	11006683	missense	probably damaging	0.99
Z1176:Irs2	UTSW	8	11006185	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GTGGCTTCCTTCAAGTGATGGGAC -3'
(R):5'- CCTTTGCCCACAATTCCAAGCG -3'

Sequencing Primer
(F):5'- ACAGGAAGTCGATGCTTGC -3'
(R):5'- CTGTGGAAAATGTCTCACTCAGG -3'

Posted On

2013-05-09