Incidental Mutation 'R4535:Fam178b'
ID 333271
Institutional Source Beutler Lab
Gene Symbol Fam178b
Ensembl Gene ENSMUSG00000046337
Gene Name family with sequence similarity 178, member B
Synonyms LOC381337, 1700024G10Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R4535 (G1)
Quality Score 220
Status Not validated
Chromosome 1
Chromosomal Location 36601773-36722264 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36639606 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 293 (D293E)
Ref Sequence ENSEMBL: ENSMUSP00000124023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114981] [ENSMUST00000170295]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114981
AA Change: D293E

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124023
Gene: ENSMUSG00000046337
AA Change: D293E

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:FAM178 89 371 3.4e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161062
Predicted Effect probably benign
Transcript: ENSMUST00000170295
AA Change: D293E

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132846
Gene: ENSMUSG00000046337
AA Change: D293E

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:FAM178 86 385 1e-130 PFAM
low complexity region 395 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194025
Predicted Effect unknown
Transcript: ENSMUST00000194839
AA Change: D49E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195729
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,762,162 (GRCm39) S473P unknown Het
Azin1 A T 15: 38,493,849 (GRCm39) I258N probably benign Het
Bod1l G A 5: 41,989,574 (GRCm39) A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,736,933 (GRCm39) probably benign Het
Cd200r3 T A 16: 44,774,552 (GRCm39) D188E probably benign Het
Cd4 A T 6: 124,847,414 (GRCm39) F250Y probably benign Het
Clcn4 T A 7: 7,290,813 (GRCm39) Y662F probably benign Het
Cpa2 T C 6: 30,552,020 (GRCm39) V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 33,067,751 (GRCm39) probably benign Het
Dhx57 A G 17: 80,582,511 (GRCm39) Y365H probably damaging Het
Dsg1c A G 18: 20,408,322 (GRCm39) E457G probably benign Het
Eef2k T A 7: 120,457,822 (GRCm39) Y60* probably null Het
Efcc1 A G 6: 87,730,133 (GRCm39) D482G probably null Het
Exoc4 C T 6: 33,254,179 (GRCm39) R112C probably damaging Het
Fbxl21 G A 13: 56,674,873 (GRCm39) V49I probably damaging Het
Fyco1 A G 9: 123,667,953 (GRCm39) V91A probably damaging Het
H2-M10.4 T C 17: 36,772,736 (GRCm39) E82G probably damaging Het
Hmcn1 A G 1: 150,439,531 (GRCm39) I5434T probably damaging Het
Hormad1 T C 3: 95,492,452 (GRCm39) V343A probably benign Het
Incenp T C 19: 9,861,303 (GRCm39) N450S unknown Het
Iqsec3 T C 6: 121,356,977 (GRCm39) K1035E possibly damaging Het
Ltn1 A T 16: 87,223,174 (GRCm39) V102D probably damaging Het
Mcur1 T C 13: 43,698,016 (GRCm39) T295A probably damaging Het
Pals1 A T 12: 78,871,611 (GRCm39) D397V possibly damaging Het
Pcdha3 T C 18: 37,081,013 (GRCm39) V585A probably damaging Het
Plcd4 A G 1: 74,602,627 (GRCm39) T594A probably damaging Het
Ppp1r3c T C 19: 36,711,522 (GRCm39) K83E probably damaging Het
Sesn3 C A 9: 14,233,954 (GRCm39) T309K probably benign Het
Slc38a3 T C 9: 107,533,405 (GRCm39) N251S probably benign Het
Sptbn4 A G 7: 27,067,127 (GRCm39) V614A probably damaging Het
Srsf4 A G 4: 131,601,175 (GRCm39) K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 (GRCm39) N32S possibly damaging Het
Ttll2 A T 17: 7,619,120 (GRCm39) I269N probably benign Het
Utp3 T C 5: 88,703,458 (GRCm39) V329A probably benign Het
Vmn2r102 A G 17: 19,914,975 (GRCm39) T847A probably benign Het
Vmn2r70 A T 7: 85,214,541 (GRCm39) W204R probably damaging Het
Xrcc3 A G 12: 111,770,966 (GRCm39) L321P probably damaging Het
Other mutations in Fam178b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Fam178b APN 1 36,603,484 (GRCm39) missense possibly damaging 0.90
IGL01128:Fam178b APN 1 36,683,435 (GRCm39) missense probably damaging 1.00
IGL01859:Fam178b APN 1 36,698,446 (GRCm39) missense probably damaging 1.00
R0398:Fam178b UTSW 1 36,671,487 (GRCm39) splice site probably benign
R1116:Fam178b UTSW 1 36,617,669 (GRCm39) nonsense probably null
R1613:Fam178b UTSW 1 36,639,273 (GRCm39) missense probably benign 0.01
R1623:Fam178b UTSW 1 36,683,405 (GRCm39) missense probably damaging 1.00
R2276:Fam178b UTSW 1 36,671,539 (GRCm39) missense probably damaging 1.00
R3706:Fam178b UTSW 1 36,647,529 (GRCm39) missense probably damaging 1.00
R4784:Fam178b UTSW 1 36,671,496 (GRCm39) splice site probably null
R5372:Fam178b UTSW 1 36,603,929 (GRCm39) missense possibly damaging 0.95
R5431:Fam178b UTSW 1 36,671,566 (GRCm39) missense probably damaging 1.00
R6808:Fam178b UTSW 1 36,639,216 (GRCm39) missense probably damaging 1.00
R7117:Fam178b UTSW 1 36,639,548 (GRCm39) missense probably benign 0.04
R7308:Fam178b UTSW 1 36,698,488 (GRCm39) missense probably benign
R7573:Fam178b UTSW 1 36,671,533 (GRCm39) missense probably damaging 1.00
R7678:Fam178b UTSW 1 36,603,532 (GRCm39) missense probably damaging 1.00
R9786:Fam178b UTSW 1 36,603,517 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGCAGAAGCTGTAAGTGATGC -3'
(R):5'- TGAAGTCCACCTATGACTGCC -3'

Sequencing Primer
(F):5'- CAGAAGCTGTAAGTGATGCTCTCC -3'
(R):5'- CCAGTATGGCTAAAGTGGTTCAC -3'
Posted On 2015-08-18