Incidental Mutation 'R4535:Cpa2'
ID333282
Institutional Source Beutler Lab
Gene Symbol Cpa2
Ensembl Gene ENSMUSG00000071553
Gene Namecarboxypeptidase A2, pancreatic
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location30541582-30564476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30552021 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 249 (V249A)
Ref Sequence ENSEMBL: ENSMUSP00000093771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096066]
Predicted Effect probably benign
Transcript: ENSMUST00000096066
AA Change: V249A

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093771
Gene: ENSMUSG00000071553
AA Change: V249A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Propep_M14 26 100 3.5e-25 PFAM
Zn_pept 121 400 3.4e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146936
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases. The encoded preproprotein undergoes proteolytic processing that removes the N-terminal activation peptide to generate a functional enzyme. This gene is expressed by the pancreatic exocrine cells which secrete the enzyme during digestion. This gene is located in a cluster of carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in Cpa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cpa2 APN 6 30564412 missense probably benign 0.03
IGL01832:Cpa2 APN 6 30551999 missense probably benign
IGL02233:Cpa2 APN 6 30557667 splice site probably benign
IGL02534:Cpa2 APN 6 30550768 missense probably benign 0.20
IGL03057:Cpa2 APN 6 30557727 missense probably damaging 1.00
R0931:Cpa2 UTSW 6 30552071 splice site probably benign
R1442:Cpa2 UTSW 6 30544866 splice site probably null
R1664:Cpa2 UTSW 6 30554315 missense probably damaging 0.98
R1752:Cpa2 UTSW 6 30552024 missense probably damaging 1.00
R2761:Cpa2 UTSW 6 30554194 missense probably damaging 1.00
R4913:Cpa2 UTSW 6 30554293 missense probably damaging 1.00
R5256:Cpa2 UTSW 6 30547197 missense probably damaging 0.96
R5461:Cpa2 UTSW 6 30544181 missense probably benign 0.03
R5630:Cpa2 UTSW 6 30550732 splice site probably null
R6629:Cpa2 UTSW 6 30554194 missense probably damaging 0.99
R7368:Cpa2 UTSW 6 30551990 missense probably damaging 1.00
R8140:Cpa2 UTSW 6 30544905 missense probably benign 0.10
R8163:Cpa2 UTSW 6 30564351 missense probably damaging 1.00
R8165:Cpa2 UTSW 6 30564346 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAGCGCACAGTTCTGAAGGG -3'
(R):5'- CAGTTAAATGCTGCCTGGGG -3'

Sequencing Primer
(F):5'- CACAGTTCTGAAGGGAGGGAAC -3'
(R):5'- AATTTAGTGATGTGTTTCAAAGAGGG -3'
Posted On2015-08-18