Incidental Mutation 'R4535:Efcc1'
ID333285
Institutional Source Beutler Lab
Gene Symbol Efcc1
Ensembl Gene ENSMUSG00000068263
Gene NameEF hand and coiled-coil domain containing 1
SynonymsAB041550, Ccdc48
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4535 (G1)
Quality Score224
Status Not validated
Chromosome6
Chromosomal Location87730869-87755908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87753151 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 482 (D482G)
Ref Sequence ENSEMBL: ENSMUSP00000032132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032132] [ENSMUST00000159570]
Predicted Effect probably null
Transcript: ENSMUST00000032132
AA Change: D482G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032132
Gene: ENSMUSG00000068263
AA Change: D482G

DomainStartEndE-ValueType
Pfam:CCD48 7 558 3.6e-295 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159570
AA Change: D481G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138649
Gene: ENSMUSG00000068263
AA Change: D481G

DomainStartEndE-ValueType
low complexity region 160 170 N/A INTRINSIC
coiled coil region 179 307 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
low complexity region 539 553 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159956
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in Efcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02868:Efcc1 APN 6 87751761 splice site probably benign
R0211:Efcc1 UTSW 6 87749154 missense probably benign 0.06
R0211:Efcc1 UTSW 6 87749154 missense probably benign 0.06
R1531:Efcc1 UTSW 6 87731166 missense probably benign 0.28
R1595:Efcc1 UTSW 6 87731458 missense probably damaging 0.99
R1757:Efcc1 UTSW 6 87749283 splice site probably benign
R4037:Efcc1 UTSW 6 87731508 nonsense probably null
R4534:Efcc1 UTSW 6 87753151 missense probably null 1.00
R5799:Efcc1 UTSW 6 87731182 missense probably benign 0.05
R6010:Efcc1 UTSW 6 87753729 splice site probably null
R7235:Efcc1 UTSW 6 87753798 missense probably benign 0.00
R7375:Efcc1 UTSW 6 87751856 missense possibly damaging 0.75
R7478:Efcc1 UTSW 6 87730990 missense probably damaging 1.00
R8116:Efcc1 UTSW 6 87751790 missense probably damaging 0.97
Z1176:Efcc1 UTSW 6 87732796 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GACTAGGCGATCTCTGCAAGTG -3'
(R):5'- CCACACAGGCTTCTCATCAG -3'

Sequencing Primer
(F):5'- ATCTCTGCAAGTGTCCAGGAG -3'
(R):5'- AGGCTTCTCATCAGCGCCTG -3'
Posted On2015-08-18